XTH10, XTH10 (gene) Malus x domestica

Gene Overview
Name XTH10
Gene Symbol XTH10
Type gene
Organism Malus x domestica
Synonym xyloglucan endotransglucosylase/hydrolase 11
xyloglucan endotransglucosylase/hydrolase 10
Description NA
Comment XTH
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XTH10EU494970.1-XTH10.m1Malus x domesticamRNA
XTH10EU494969.1-XTH10.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglucosylase hydrolaseXTHMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly EU494970.1-XTH10.m1 Chr06:3354338..3354824
chr6:3289846..3290332
chr6:4080826..4081312
EU494970.1
predicted genes from whole genome assembly EU494969.1-XTH10.m1 Chr16:1074165..1076412
chr10:1561384..1563631
EU494969.1

Sequence(s):
>EU494970.1-XTH10.m1486
gaagaaatgggtgctgactatccttcaaagccaatgtcgttgtatacgactatatgggatgcaagcagttgggctacgtc
cggtgggaaatacaaggtgaattacaaatatgcccccttcgtggcagagttcaaagacctagccctagagggctgccctg
ccgacccaatccagcaaatccctcctgctgaagcgtgtgcggaacattacacccacctcgccacccaagactactccgtc
atttcgcctcagcggcgagctgccatgagcaggtttcggcagcgttacatgtactactcatattgctatgattcgctgcg
ttacccagtgccaccacccgagtgcgttaccgttcctgccgagaaggcacgcttcaaggacactggcaggttgaagtttg
gcggcagccacaaacgacagtccaagcggaagtcccacaaacgcaaccgagcagtccctaactccgacaacgctgcagac
atatga
back to top
>EU494969.1-XTH10.m11011
atggggttttttcatctgggattgtttctgtgtgcctgtcaagtgcttgttcttggagttgttgcttctgcaccctccgg
aaagttaccaatcataccctttgatgaagggtacaccaagctttttggtgatgacaatttgatgattcttagagatggga
aatccgtccatctctcgctagacgaacggacagggtctggatttgtttctcaggacctctaccagcatgggtttttcagt
gcttccattaagctgcctgctgattatactgctggagttgttgtggcgttttatatgtcgaacggtgacatgtttccgaa
gtaccatgatgaaattgatttcgagtttttggggaacatacggggcaaagaatggagggttcagaccaacatttacggca
acggaagcaccaacaccggcagggaagagagatacaatctatggtttgatccatccgacgattaccatcagtacagcatt
ctctggactgacattcagatcatcttttatgttgacaatgttcccattagagagttcaagaaaacaaaatcaatgggtgg
tgacttccccgctaagccaatgtcattgtacgccacaatatgggatggatctgattgggctaccaacgggggcaaatacc
gagtgaattacaagtatgctccctatttggctgagttctctgaccttgttctacacggctgtgcagtcgatccaattgaa
caattatcaaagaaatgcgaaaacacccaaagttcagaatcggtccctactggcgttacccgccttcaaagaatgaagat
ggagagtttcaggaagaagcacatgacatactcctactgctatgacagaatccgttacaagtcccctccttcagagtgtg
tgatcaatccccaagaagctgaaagactgcgtgtatttgaccctgtcacattcgggaaagggaggcgccgccatggaaag
catcaccaccggagcagagtaagccaggcagatgaggcaacttctatttga
back to top