XTH1, XTH1 (gene) Fragaria chiloensis

Gene Overview
Name XTH1
Gene Symbol XTH1
Type gene
Organism Fragaria chiloensis
Synonym xyloglucan endotransglucosylase/hydrolase 1
Description NA
Comment xyloglucan endotransglucosylase/hydrolase 1
Fc-XTH1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XTH1JQ619782.1-XTH1Fragaria chiloensisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XTH1GQ280283.1-XTH1.m1Fragaria chiloensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglucosylase hydrolaseXTHFragaria chiloensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JQ619782.1-XTH1 N/A JQ619782.1
mRNA parsed from NCBI nr database GQ280283.1-XTH1.m1 N/A GQ280283.1

Sequence(s):
>JQ619782.1-XTH11369
tgaagtcctatcgacgggcttcttcccccaccatggttcagacaacgatgccagaactgctttcgtgagagccacttcgt
gttgtgaccttcaactcgccgaggatgaacaggacttcgagctgtatgcccccaatcacttcgcgaggcaactcggcttc
catcaagggatcccctatccacttctctattcggtcaacaagtacccctcgtggaggaaagttggcgagtccgaccgggt
caccccgctgcaaaacatctaccctctttcccccaacttgctggagattgagccttcgcagggcgtcgaccccgcctacc
tcacttggtggcggtcattgcccgacaaccaatgggagttcccagacgatgctgtctttgccgccatctttcgtcctcta
tacgacactctgggcgaatcagaccgcgtcatcctcgatggccagcgcgaccgtgcggagaggggttcaggggctgcgat
aggaactaggcttgcgctcccgccaggtcctgctactcgccgcccgacagggatcatcattcgagaacgcgaccccgcac
ccgaggtatgtcactaaatgcgtaaatttcaaacctcctttaatatattgacaaaatgcttttttctgaccctcttgttt
accttttcagtctgccccccgccggagaacaatcaacagatttgggggtgccagaggaaaagcacctgtccgaaaggaaa
ctgtggcgggccacgacagtgagactgctcccgtcattccctggccaacgagcggcgaaagctcgcggaagcatcccatt
gaggatgaagaagagctgttagaggatgagcagtatcaacgggagtatgccttggtaagcaacccggtaagcgaaccatc
ttcgaattaaattttcctaaagtcagtcaacgactcgctaactttgcctttgacaggttcgctgcacccgacctcgcctc
gctgtcgttgaagaggcgatagtgatagcggaagacccgcctccagaaccactcgttggagaagtgaccttggccatcga
gggggttaccgtggcaagcgcggagatggtcatcgaggaaattgctgaagtcagcgaggagctggccctcgaagaagttg
ctgaagctagcgtggaggcgaccgtcgaggaagtcggtgcagccaacggggagatggtcaccgagggaagttggtgcggc
cacggaggaagtcatcatggccgtcgaggaggttgacatggctattgaggaattcaccgtgcaaccggcttcttcaaacg
ccattccaagcgaaactggtccaatctcggagcctatctcggctctcgctgaagctctttactgcccctttggcatttcc
gccagaagg
back to top
>GQ280283.1-XTH1.m1885
atggcttcttcccagcaatgtactctgctcttgagcataatgcttatgggctctgtaacaatggcagctcccccaaaaag
gcccgtgtctgtaccattcggaagaaactacatgcccacctgggcttttgaccacatcaagtacttcaatggtggcaatg
agattcagctccaccttgacaaatacacaggtactggtttccaatccaaaggctcatacttgtttggccatttccatatg
caaatcaaattgccccctggtgattctgctggaactgttactgctttctatctgtcttctacaaacgcagagcacgatga
gatcgacttcgagttcttggggaacagaacagggcagcccttcattttgcagaccaatgtcttcaccggaggtaaaggtg
accgtgaacagaggatcttcctctggttcgacccaaccaaagagtaccactcctactctgtcctctggaatctctaccag
attgtattcttcgtggatgacatcccaatccgagtgttcaagaacagcaaagacttgggagtgaaattcccattcaacca
acccatgaagctctactctagtctgtggaacgccgacgattgggccaccaggggaggactcgagaaaaccgactggtcca
aggctcccttcgttgccacctacagaggcttccacatcgacggctgcgaggcctcagtacaagccaggttctgtgccaca
cagggtaagaggtggtgggatcagaaggagttccaggaccttgatgcttatcaatggaggaggcttaggtgggttagaca
gaggttcaccatctacaactactgcactgacaggactaggtatcctactctccctgcagaagtgcagagagacagagaca
tatga
back to top