XTH1, XTH1 (gene) Fragaria x ananassa

Gene Overview
Name XTH1
Gene Symbol XTH1
Type gene
Organism Fragaria x ananassa
Synonym xyloglucan endotransglucosylase/hydrolase 1
Description NA
Comment Fa-XTH1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XTH1JN602076.1-XTH1Fragaria x ananassagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XTH1JN602076.1-XTH1.m1Fragaria x ananassamRNA
XTH1GQ367550.1-XTH1.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglucosylase hydrolaseXTHFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JN602076.1-XTH1 N/A JN602076.1
mRNA parsed from NCBI nr database JN602076.1-XTH1.m1 N/A JN602076.1
mRNA parsed from NCBI nr database GQ367550.1-XTH1.m1 N/A GQ367550.1

Sequence(s):
>JN602076.1-XTH1891
tgagttagagaggaggtggtaaatttcttttggtgtcatgaattcggatagctacttattgatccacaactggccaactt
atcaaaccatgatggatgtgctgaactcttttcagatatttgcgtctttgcagagaacagttccttagctagctgtgtcc
aaatgcagaatcccaaagaacagaagacaaaagtctggttctttatccatgaccatatttttgcccggtttcaccgcaaa
agattaaaacacagcgacaataaaacaaatatagaacgaccaataattgaaatgctaaaattgtaagagttttacaacgt
ttcgaagtattgaaactatgaaatcgaaaacccaagaactgtcgaatttcctaagctaatctaacgattcaagactagaa
atctagaattcagttttgtgtagtaccggggagaacctcaaaacttgttttctcaaaacgtttttttgtaggatttcata
agcacatttgcttcctctgtttcgaagccaggaataattgaatagctgtcctgctgctattgatataaaaatcacatcat
aaaataattaaataacaatgccattggttaaaggttatttgcacacagccccccatcaattatgtaatgtggatgaaatc
atacccctattaaaggaccctcccctcctccccatttcctcatcgcaactcgaaccattctatctcactccctctctgtg
ttgccagaggtaaggcttccaccttctctagtcccattatcatctgaaagtttcaagcttttctagttttgaatctaaat
ttgggagcttttttgttttgtttttgcagagaaaaatgtcttcttccaagcaatggactctgctcttgagcatagtgctt
atggtctctgt
back to top
>JN602076.1-XTH1.m156
atgtcttcttccaagcaatggactctgctcttgagcatagtgcttatggtctctgt
back to top
>GQ367550.1-XTH1.m1885
atgtcttcttccaagcaatggactctgctcttgagcatagtgcttatggtctctgtaacaatggcagctcccccaaaaag
gcccgtgtctgtaccattcggaagaaactacatgcccacctgggcttttgaccacatcaagtacttcaatggtggcaatg
agattcagctccaccttgacaaatacacaggtactggtttccaatccaaaggctcatacttgtttggccatttccatatg
caaatcaaattgccccctggtgattctgctggaacggttactgctttctatctgtcttctacaaacgcagagcacgatga
gatcgacttcgagttcttggggaacagaacagggcagcccttcattttgcagaccaatgtcttcaccggaggtaaaggtg
accgtgaacagaggatcttcctctggttcgacccaaccaaagagtaccactcctactctgtcctctggaatctctaccag
attgtattcttcgtggatgacatcccaatccgagtgttcaagaacagcaaagacttgggagtgaaattcccattcaacca
acccatgaagctctactctagtctgtggaacgccgacgattgggccaccaggggaggactcgagaaaaccgactggtcca
aggctcccttcgttgccacctacagaggcttccacatcgacggctgcgaggcctcagtacaagccaggttctgtgccaca
cagggtaagaggtggtgggatcagaaggagttccaggaccttgatgcttatcaatggaggaggcttaggtgggttagaca
gaggttcaccatctacaactactgcactgacaggactaggtatcctactctccctgcagagtgcaagagagacagagaca
tatga
back to top