XTH2, XTH2 (gene) Fragaria chiloensis

Gene Overview
Name XTH2
Gene Symbol XTH2
Type gene
Organism Fragaria chiloensis
Synonym xyloglucan endotransglucosylase/hydrolase 2
Description NA
Comment Fc-XTH2
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XTH2GQ280284.1-XTH2.m1Fragaria chiloensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglucosylase hydrolaseXTHFragaria chiloensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database GQ280284.1-XTH2.m1 N/A GQ280284.1

Sequence(s):
>GQ280284.1-XTH2.m1975
atgggttactacttggttgctttggttgttcttgtagcagttgtgtctgcctcagccaaaactctaccaatcatgtcctt
tgatgaaggatacaacaagctctttggggacgacaatctgatgattcttaaggacgggaaatccgttcatcttacgttag
acgaacggacagggtctggatttgtttctcaagacctttacattcatgggttcttcagtgcctctattaagttaccaact
gattatactgccggagttgttgtcgccttttatatgtcgaattctgacatgttccccaagaaccatgacgaaatcgattt
cgagtttctggggaatataagagggaaagagtggagggttcagaccaacgtttatggcaatggaagcactgaaactggga
gagaagagagatacaatctctggtttgatccttctgaggattaccaccagtacagtattctctggactgactctcaaatc
atattctatgttgacaatattcccattagagtggttaagaaatcagagtcgatgggtggtgattatccctcgaagccaat
gtcattgtatgctacaatatgggatggatctggttgggctaccgatggaggcaaatacagagtcaactacaagtatgcac
cattcagggccgagttctctgaccttgttctgcatggctgtgcagttgatccaattgaacaggtatcaaagaaatgtgat
aaaacccaaggttctgaatatatccctaccggtgttacccgcctacaaagaatgagaatggagagtttcaggaagaggca
gatgacatactcctattgctacgacagaataagatacaaggtagctccaccagagtgtgtgatcactcccccagaagctg
aagactccgtgtgtttgaccggttacttcgggcatgacacgtcgtcacgaaactcacacaggacagcacaagcagcgtac
aacactctctgttag
back to top