XTH2, XTH2 (gene) Fragaria x ananassa

Gene Overview
Name XTH2
Gene Symbol XTH2
Type gene
Organism Fragaria x ananassa
Synonym xyloglucan endotransglucosylase/hydrolase 2
Description NA
Comment Fa-XTH2
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XTH2JN602077.1-XTH2Fragaria x ananassagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XTH2JN602077.1-XTH2.m1Fragaria x ananassamRNA
XTH2GQ367551.1-XTH2.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglucosylase hydrolaseXTHFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JN602077.1-XTH2 N/A JN602077.1
mRNA parsed from NCBI nr database JN602077.1-XTH2.m1 N/A JN602077.1
mRNA parsed from NCBI nr database GQ367551.1-XTH2.m1 N/A GQ367551.1

Sequence(s):
>JN602077.1-XTH21238
ccttggtggccagccggtggtgaggccatgtgcttgttcgcgttcctgtcttatggcgatgcaatggaatagtttggcaa
ttgctgggataccctgcattgctttagcgtgttacctaatctaacaaaggttaaactctccctcaaaaaaaaaaaagtga
tataaatttaaaaattactatatttggatatatgattaacatgatatttattgtaggataataggtaattcgtcatcaca
cgtcactcgtgctagaagtgaaaaattactgcccccgtattagcaattaggtatatgatatgattacacgctattaattc
taaatgcacatttaaagaaacaaaatctcccattatcatatagatggatgaaaacacatatcaccttaattgaagaaagg
aagaacaatatccacttcatgacatggattacagaaaatcacctcaaaactgcaaaatcatctcgatcaaaactaattca
tacacggtgacagtgcactttttaacagaacattgcataacacaatcttatgcatttatattacgcaaattctcaaagaa
cataagaatagaagaaaagtttatcatctggagatttgtaattgaaagtctaaataatattaatttgctaagaaaaaagg
aaaaggatattatgcaaattctcaaagaaaataagaagagaagaaaagtttatactttagggtttgtaattgaaaatcta
aataatatttgctaagaaaaaggaaaaatagacaaaaggtggtgcaaatgtgcatatgaagaggacaccgctcaacagct
ctctctcccaccggacacactctctctttctctctcacacacagcaataaaatgagaagcccttggcattgtctatctct
ctctcatttccattagccttcttttgggttctctctctctctctctatctcccatagctgtagaaatttaattcagagag
atactcctccccttctctctccttctctctctctctccctctccgtctatccataaaaacaaggggagagagaaataata
tactcaatcagaaacaacagaaaccaaaaccatctgcttgttgttaaggattaaggattaaggaagaagaagatgggtta
ctacttggttgctttggttgttcttgtagcagttgtgtctgcctcagccaaaactctaccaatcatgtcctttgatgaag
gatacaacaagctctttggggacgacaatctgatgatt
back to top
>JN602077.1-XTH2.m1126
atgggttactacttggttgctttggttgttcttgtagcagttgtgtctgcctcagccaaaactctaccaatcatgtcctt
tgatgaaggatacaacaagctctttggggacgacaatctgatgatt
back to top
>GQ367551.1-XTH2.m1807
ctaccaatcatgtcctttgatgaaggatacaacaagctctttggggacgacaatctgatgattcttaaggacgggaaatc
cgttcatcttacgttagacgaacggacagggtctggatttgtttctcaagacctttacattcatgggttcttcagtgctt
ctattaagttgccaactgattatactgccggagttgttgtcgccttttatatgtcgaattctgacatgttccccaagaac
catgacgaaatcgatttcgagtttctggggaatataagagggaaagagtggagggttcagaccaacgtttatggcaatgg
aagcactgaaactgggagagaagagagatacaatctctggtttgatccttctgaggattaccaccagtacagtattctct
ggactgactctcaaatcatattctatgttgacaacatttccattagagtggttaagaaatcagagtcgatgggtggtgat
tatccctcgaagccaatgtcattgtatgctacaatatgggatggatctggttgggctaccgatggaggcaaatacagagt
caactacaagtatgcaccattcaaggccgagttctctgaccttgttctgcatggctgtgcagttgatccaattgaacagg
tatcaaagaaatgtgataaaacccaaggttctgaatatatccctaccggtgttacccgcctacaaagaatgagaatggag
agtttcaggaagaggcagatgacatactcctattgctacgacagaataagatacaaggtagctccaccagagtgtgtgat
cactccc
back to top