XTH2, XTH2 (gene) Rosa hybrid cultivar

Gene Overview
Name XTH2
Gene Symbol XTH2
Type gene
Organism Rosa hybrid cultivar
Synonym xyloglucan endotransglucosylase/hydrolase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglucosylase hydrolaseXTHRosa hybrid cultivargene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XTH2AB428379.1-XTH2.m1Rosa hybrid cultivarmRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB428379.1-XTH2.m1 N/A AB428379.1

Sequence(s):
>AB428379.1-XTH2.m1867
atggcttcttcaacttcaatgcttctgttcgttccatttctgctaattagctctgttatggttgcctcagctggtaactt
caaccaagactttcaggttacatggggggacggtcgagccaacatactcaacgacggccaacttcttactctctccctcg
acaaaacctctggctctggttttgaatccaaaaacgaatacctcttcggcaagattgacatgcagctcaagcttgtcgcc
ggaaactctgctggcaccgtcaccgcctactatttaaaatcagaagggtctacatgggatgagatagactttgagttctt
gggaaacctgagtggcaacccttacactcttcacaccaatgtcttcagccaaggcaaaggaaacagagaacagcaattcc
atctctggttcgacccaactgctgatttccacacctattccattctctggaatccacagcgcattgttttctctgttgat
ggtactcccattagagagttcaagaaccaagagtcgaatggtgttccattcccaaagagccaaccaatgagaatacactc
gagcctctggaatgctgatgattgggcaacaatggggggacgtgtaaagacggattggaatacagctccgttcactgcct
cttacaggaatttcaatgctgaagcatgcatttgggcttctggatcatcttcttgtggttcaagcagtgcccctgcttcg
actaatggagattggctttcgcaagaattggacagtgctagttatgaaaagctgagttgggtgcagaaaaactacatgat
ctacaattactgcacagatgtcaacaggttccctcagggtctcccagttgaatgcagcacttcatag
back to top