XTH3, XTH3 (gene) Malus x domestica

Gene Overview
Name XTH3
Gene Symbol XTH3
Type gene
Organism Malus x domestica
Synonym xyloglucan endotransglucosylase/hydrolase 3
Description NA
Comment XTH
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglucosylase hydrolaseXTHMalus x domesticagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XTH3EU494962.1-XTH3.m1Malus x domesticamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly EU494962.1-XTH3.m1 Chr10:39902684..39904359
chr10:31424584..31426259
EU494962.1

Sequence(s):
>EU494962.1-XTH3.m1903
atggaaagaagggcgtctccgatgcctgttcttctttatattgcagctctcatggctgcttcttgttgttcttcatcaga
ggcagctgccccaaaaagttctttcgaggacaatttcgatataatgtggtctgaggaccattttacaacttcagaagata
agcagatctggtatctttccctcgacaaagacacgggttgtggatttcaaacgaaacaaaagtacagatttggatggttt
agcatgaagatcaagttggtcggaggtgactccgccggcgtagtcacagcttattatatgtgcaccgaaaatggagcagg
gccagagagggatgagctagattttgagttcttggggaataggagcgggcaaccttatctgatccagacaaatgtgtaca
agaacggaactggaaaccgtgagatgaggcaccaactttggttcgaccccactgaggaatatcatacttactcaattctc
tggaataatcatcagattgtgtttttcgtggacaaagttcccataagggtgttcaagaacaatggggaagcaaacaactt
cttccccaatgagaagccgatgtacttattctccagcatatggaacgcagacgaatgggccaccagaggtgggattgaga
agacagactggaagaaatcaccatttgtgtcctcctacaaggacttcagtgttgatgcctgccaatgggaggacccattc
cctgcgtgcgtctccaccacaacaaaaaactggtgggaccagtatgatgcctggcacctatcagatgcccagaagaagga
ttttgcttggatacagagaaatatggtgatttatgattattgcaaggattctgaacgcttcccaacattgccagtggagt
gcccattgagtccatgggaataa
back to top