XTH8, XTH8 (gene) Rosa x borboniana

Gene Overview
Name XTH8
Gene Symbol XTH8
Type gene
Organism Rosa x borboniana
Synonym xyloglucan endotransglucosylase/hydrolase 8
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XTH8JX259262.1-XTH8.m1Rosa x borbonianamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglucosylase hydrolaseXTHRosa x borbonianagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JX259262.1-XTH8.m1 N/A JX259262.1

Sequence(s):
>JX259262.1-XTH8.m1581
ggtcgactcatgatgaaatagacttcgagtttcttggcaacctaagcggagatccttatattctacacacaaatgttttc
acacaaggcaagggaaatagagagcagcaattttatctttggttcgatcccaccaaagacttccacacctactccgtctt
gtggaaccctcaaagcatcatattctctgtcgatggcacacctattcgagagttcaagaatttaggatcgaggggaatcc
cattcccaaagaaccaagcaatgtggatctactcaagcctttggaacgcagatgactgggcgacacgcggtggacttgtg
aagacagactggagtaaagctccattcacagcctcgtacagaaacttcaacgcccaagcatgcatttggtcttctggttc
ttcctcttgttcttcttctccttctagttcttcaaaagaggcatggttcacccaatcattggatgccacagggaaagaaa
gaataaattgggttcaaaagaactatatgatctacaactattgcaaggataccaagcgcttcccacagggacttcctctt
gaatgcacagtagttaattga
back to top