Xth2, Xth2 (gene) Fragaria chiloensis

Gene Overview
Name Xth2
Gene Symbol Xth2
Type gene
Organism Fragaria chiloensis
Synonym NA
Description NA
Comment xyloglucan endotransglucosylase/hydrolase 2
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Xth2JQ619783.1-Xth2Fragaria chiloensisgene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglucosylase hydrolaseXTHFragaria chiloensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JQ619783.1-Xth2 N/A JQ619783.1

Sequence(s):
>JQ619783.1-Xth21500
aggaagattggcgagtctgaccgggtcaccccgctacagaacattttccctctcactcctgacttgctggagattgagcc
ttcgttgggtgttgaccccgtctatctctcttggtggcgatccttgtccgacaaccattgggggttcccagatgatgctg
tcttcgccgccatctttcatcctctatacgacactctgggcgaatcagaccgcgttattcttgacgcccagcgcgatcgt
gaagagagggattcaagggctgcgacgggaactaggcttgcgctcccaccagttcctgctattcgcctccctacggggat
cgtcattcaagaacgcgatcccgcatccgaggtatgtcactaagtgtgtaaattccattccgccttttaccacctcgaca
aaatgcttcttcctaactctcctgtctacctttacagtctgccccccgccggagaactatcagaagacctaagggtgtca
gagacaaaggaaaaacacctgcccaaaaggaaaccgcggtggaatgacagtgagactgctcccgtcattccgcccgtcac
tcgcgttgcgttaattacactcaatcgagtgagtaatccgtggggtccgaaatgtgaaatacgaaggccgagcatacaac
acaccttaacactcgcctattgttaaagtgtgtcctttgtcgatactggtactaatgcggttcgataaatccactgtgat
atcttatgagttcgatacgtaggttgcgcaaccctcgagagggtataccagctggacgtccgccggcgcttaagtgatca
ctaatgatatcccgtgcgcaccagctgccgggcccgaccatagggataagaaagtgttagaatttgtggtgtttgggaaa
ctgtgtgagtttgtggtgtggtacataggttcgtgtttgggaaaagagagttgggaggagaaccactagtagagatagta
agactagttgaaagggtactgttgttacaggctgttaggtacgcgtataggtacaataggaggtggatggccatgatgat
gttgaggttgaggccactggtggtgcggcggaggcggatggtgttgttgttgcataggtggaggccagatgggatgaggc
tgacctatgatgggaatgttgggaggcggttcactaatgttgccgccaccaccgatgccgatgccaggaggaggaggact
gggataggacggaataaaaggaaagatgatgtttgtaccacgagtacctctgcggagtagctctctcatttccattagct
ttcttttgggttctctctctctatctcccatagctgtagaaatttaattcagagagatactcctccccttctctctcctt
ctctctctctctctctccctctccctctatctataaaaacaagggagagagaaataaaatctcaatcagaaacaggagaa
caaaaccatctgctttggttgttaaggattaaggattaaggattaaggaagaagaagaag
back to top