pseudo PamSFB1, pseudo_PamSFB1 (gene) Prunus mira

Gene Overview
Name pseudo PamSFB1
Gene Symbol pseudo_PamSFB1
Type gene
Organism Prunus mira
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
pseudo PamSFB1AB725590.1-pseudo_PamSFB1Prunus miragene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus miragene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB725590.1-pseudo_PamSFB1 N/A AB725590.1

Sequence(s):
>AB725590.1-pseudo_PamSFB11344
aagaaagaaatcttaatcgacatcctattgagactacctgcaaaatcgcttgttcgatttctgtgtacatgcacgttatg
ggctgatttgattggcagctccagttttgtcagcacacaccttcataggaatgtcacaggacatgcccatgcatatctac
tttgcctccaccacccaaattttgaatgtcaaagggacgatgatgacccgtattttaaagaagaactccaatggtcactt
ttttccaatgaaacatttgtgcaatgcttccagttaaaccatcccttagggagaacagaacattatggcatatatggttc
aagcaatggtttagtttgcatttcggatgagatgttgaatttcgatagtcctatacacatatggaacccatcggttagga
aacttcggacccctccaatcagcaccaacattaacattaaattgagctatgttgctctccaattcgggttccaccccaga
gttaatgactacaaggctgtaagaatgatgcgcagtggcggatccaggattatgtggctaagggggcttagtgtaaaagt
tccgaaatttttctacaaagaggggctgtggaggttagggtttgagatggtgggagaagaggggctgtggaaattctgaa
atttggttctgtttctgtcgaagcaagtttgctgctgttatgttttgtgcagttttttttttttttttttttttttacgc
caacgttttgaggccaggtcaattaaaaaaaaatttgactcagccttgaccaaacgacgtcgtttggcaaggcaggtttt
aaaaaaaattacaacccgcgcagcgcaggctgcgcaggctcagcacagctgcacagcagctcgtcttctcttgtgggact
tccgtcgagcacttggtgtgcgtacaagggggcttccagcagctgtccaagggggctttcatggagtcccttgccaaatt
tccagccttccaaggggtcgtccgacccctcttgtcccaacgtgcatccgcctctgatgatgcgtactaacaaaaatgcc
gtcacagttgaggtttatagtcttaaaacagactcttggaaaatgattgacgcaattcctccttggttaaaatgcacttg
gcagtatcacaggggtacattctttaatggagtagcatacaacgtcattgagaaaggtcctatattcagcattatgtcct
tcgattcaggcagtgaagaattcgaagaattcatagcaccaaatgccatttgcggttcatgggggttatgcatcgacgtt
tacaaggaacaaatttgcctgctttttagatgttatggttgtgaggaggaggaggagggcatgg
back to top