pseudo PamSFB4, pseudo_PamSFB4 (gene) Prunus davidiana

Gene Overview
Name pseudo PamSFB4
Gene Symbol pseudo_PamSFB4
Type gene
Organism Prunus davidiana
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
pseudo PamSFB4AB725593.1-pseudo_PamSFB4Prunus davidianagene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus davidianagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB725593.1-pseudo_PamSFB4 N/A AB725593.1

Sequence(s):
>AB725593.1-pseudo_PamSFB41110
ctacgtaagaaagaaatcttaatcgacatcctagttagactacctgcaaaatccctcgttcggtttctgtgtgcatgcaa
gtcatggagtgatttgattaacagctcgagttttatcaccacacagcttaacaggaatgtcaccaaacacctccatgtct
ctctactttgcctccactaccccgatctcaaacgtcctttcgagttctacgaaaactacgaggactacccagatcttaaa
cgagaattggaatggtcacttttctccaacgaaacatttgagcattgctccaagttaaaccatcccttggggatcaagaa
agattatagggtatatggctcaagcaatggtctagtttgcatttcagatgacaaattggacaccaagagccctatacaca
tatggaacccctcggttaggaaatttagaacccttccaaagagaaccaacgttaaatttggctacattgctctccaattc
gggttccaccctggggttaacgactacaaggttgcagggatgttgcacgtccacaaagacgatgctttcgcagtcgaagt
ttatagtctcagcacagactcttggaagatggttgaagaacatcctctttggttaaaatgcacttggcagaaccataggg
gtacattttataatggagtagcataccacattatcgagaaatttcttctattcagcattatgtcattcgattcgggcagc
gaaacattcgaagagttcatagcaccggatgccattagatgttggtcacggctgcatattgaggtttacaaggatcaaat
ttgcttgctttattatttgagattgtttcattgatttgtgaggaagaaggcatgtcacaaattgagtttggggttatcca
agaaaaacgatggaaacaaatgcgtccttttctttatccttccgactactactttgtagtcgggtttagtatagataatg
aactattaatggagcgaagcggttatggcaatgctctgtatttgtgcaactatgaatccaagcaatatcgtgagacaggg
attgagttggccatctcgagaaatgaccctgagcagctcttgtttgcaattacttacatagaaagtttgg
back to top