pseudo PamSFB5, pseudo_PamSFB5 (gene) Prunus mira

Gene Overview
Name pseudo PamSFB5
Gene Symbol pseudo_PamSFB5
Type gene
Organism Prunus mira
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
pseudo PamSFB5AB725594.1-pseudo_PamSFB5Prunus miragene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus miragene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB725594.1-pseudo_PamSFB5 N/A AB725594.1

Sequence(s):
>AB725594.1-pseudo_PamSFB5834
tgttcggtttctttgtacatgcaagtcatggagtgatttgattggcagctccagttttgttagcacacaccttaatagga
atgtcaataaacatgcccatgtctatctactttgcctccaccatccaaattttgaatgtgtggtggaccctgatgaccca
tagttagaagaagaagttcaatggtctctttttcccaatgaaacatttgaggagtgctccaagttaaaccatcccttagg
gagcacagaacattatgggatatatggctccagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtc
ctatacatatatggaacccatcagttaggaaacttaggacccttccaataagcaccaacatcattaaatttagccatgtt
gctctccagttcgggttccataccagggttaatgactataaggccgtaaggatgatgcgtaccaacaaaaatgccttggc
ggttgaggtgtatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaagtgcgcttggcagc
attataagggtacatttttcaatggagtagcataccatatcattgaaaaaggtcctatattcagcatcatgtccttcgat
tcaggcagtgaagaatttgaggaattcatagcaccagatgcaatttgtcgtccatctgaggtatgtattgacgtttacaa
ggaacaaatttgcttgctttttggattttatcgttgtgaggacaagggcatggataaaattgacttgtggattctgcgag
aaaaacggtggaaacaattgtgtccttttatttt
back to top