s-RNase, s-RNase (gene) Prunus dulcis

Gene Overview
Name s-RNase
Gene Symbol s-RNase
Type gene
Organism Prunus dulcis
Synonym ribonuclease S11 precursor
Description self-incompatibility
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
s-RNaseAM231660.1-s-RNasePrunus dulcisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
s-RNaseAM231660.1-s-RNase.m1Prunus dulcismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus dulcisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AM231660.1-s-RNase N/A AM231660.1
mRNA parsed from NCBI nr database AM231660.1-s-RNase.m1 N/A AM231660.1

Sequence(s):
>AM231660.1-s-RNase1095
cttgttcttgcttttgctttcttcttttgttacgttgtgagcagtggtgggttgcattacaatctttcgctatatcctat
atgcagataatcagcattgcaagttttttttttttttttttgtgaacagcattgcatttttcacttatattttttgttca
gagaactattgtgtgtattcgatgatatatcacatgacatgcggtatactgaattcacccacatatttttcatttaatct
aacgcacaactttctttggatgagtaagtatttggggattgtttttctgcatgtcctcttttttattttcatcctctttt
gttctttctgataattgttgcaataagtgcagtctattcatcacaataattttggcaggatcttatgactactttcaatt
tgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaaaccccggccattacaaaatttca
ccatccacggcctatggccaagtaattattcaaacccaacgaagcccagtaattgcaacgggtcaaaatatgaggacagg
aaagtggtaggtcataaattttttactttctctctagtttttagaaaattaaattgtcaagtgaagataataactaccaa
aatatgaaaatctatctatccctttttagccccccccccccaaaaaaaaaaaaaaaaattcaaactatcctttaaggtta
ttctttttctgaaaatatgtctacattgtttgcatgtctcagtaccctaaattgcgatccaaactgaagagatcttggcc
cgacgtggaaagtggcaatgatacaagattttgggaaggcgaatggaacaaacatggcagatgttccgaacagacactta
accaaatgcaatacttcgagatatctcacgacatgtgggtgtcgtacaatattacagagatccttaaaaacgcttcaatc
gtaccacatccgacacaaaaatggagctactccgacatagtatcacccattaaaacagcaactaaaagaacacccctcct
tcgctgcaaaactgatccagctactaatactgagttgttacatgaagtggtattt
back to top
>AM231660.1-s-RNase.m1567
cttgttcttgcttttgctttcttcttttgttacgttgtgagcagtggatcttatgactactttcaatttgtgcaacaatg
gccaccgaccaactgcagagttcgcatcaagcgaccttgctccaaaccccggccattacaaaatttcaccatccacggcc
tatggccaagtaattattcaaacccaacgaagcccagtaattgcaacgggtcaaaatatgaggacaggaaagtgtaccct
aaattgcgatccaaactgaagagatcttggcccgacgtggaaagtggcaatgatacaagattttgggaaggcgaatggaa
caaacatggcagatgttccgaacagacacttaaccaaatgcaatacttcgagatatctcacgacatgtgggtgtcgtaca
atattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaaaatggagctactccgacatagtatcaccc
attaaaacagcaactaaaagaacacccctccttcgctgcaaaactgatccagctactaatactgagttgttacatgaagt
ggtattt
back to top