ANR, GU938688.1-ANR.m1 (mRNA) Prunus avium

Transcript Overview
Unique NameGU938688.1-ANR.m1
OrganismPrunus avium ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ANRANRPrunus aviumgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
GU938688.1-ANR.m1-cds1GU938688.1-ANR.m1-cds1Prunus aviumCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ANRGU938688.1-ANR.p1Prunus aviumpolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
GU938688 region GU938688:1..1017+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productanthocyanidin reductase
The following sequences are available for this feature:

mRNA sequence

>GU938688.1-ANR.m1 ID=GU938688.1-ANR.m1|Name=ANR|organism=Prunus avium|type=mRNA|length=1017bp
back to top

protein sequence of ANR

>GU938688.1-ANR.p1 ID=GU938688.1-ANR.p1|Name=ANR|organism=Prunus avium|type=polypeptide|length=338bp
back to top

mRNA from alignment at GU938688:1..1017+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU938688.1-ANR.m1 ID=GU938688.1-ANR.m1|Name=ANR|organism=Prunus avium|type=mRNA|length=1017bp|location=Sequence derived from alignment at GU938688:1..1017+ (Prunus avium)
atggccacccaacccatctcaaagaagacagcctgtgtgatcggaggtac agggttcgtggcatctttgctggtgaagctgttgctagagaagggctatg cggtcaaaaccactgtcagagaccctgacaatcagaagaagatctctcac ctcacagcactacaagatttgggtgaactagaaattttaggagcagatct aactgatgaagggagctttgatgcccccatagcaggttgtgaccttgttt tccatgttgccacgcctgtcaacttcgcctctgaggaccctgagaaggat atgattaaaccagcagttcaaggggtgcaaaacgttcttaaagcatgtgt gaaagccaaaacagttaaacgcgttgttttgacatcatcagcagctgcag tgtcgatcaacacacttaatggaacaggtttggtcacagacgagaacgat tggagtgatgtcgagttcttgagtactgcaaagccacctacttggggcta tcctgcctccaagacactagccgagaagacagcttggaaatttgccaaag aaaacaacattgacctcatcaccgtcatcccttctcttatggctggttat tctctcactccggacgtccccagcagtatcggcctagccatgtctttaat tacaggaaatgacttcctcataaatcatgccttgaaaggtatgcaactac tatcaggttcaatctccattacacatgtggaggatgtctgccgggctcat atatttttggctgagaaagaatctgcttctggtcggtatatatgctgcgc tgtcaataccagtgttcctgagcttgcaaagttcctcaacgaaagatacc ctgagtacaaagtccccactgagtttggagattttccctcaaaggccaag ttgatcctctcttcggagaagcttatcaaggaggggttcgactttaagta cgacattgaacaaatatatgaccaagctgtggactacttcaaggctaagg ggctgctgcagaactag
back to top

Coding sequence (CDS) from alignment at GU938688:1..1017+

>GU938688.1-ANR.m1 ID=GU938688.1-ANR.m1|Name=ANR|organism=Prunus avium|type=CDS|length=1017bp|location=Sequence derived from alignment at GU938688:1..1017+ (Prunus avium)
back to top