LFY-1, JN788259.1-LFY-1.m1 (mRNA) Fragaria x ananassa

Transcript Overview
Unique NameJN788259.1-LFY-1.m1
OrganismFragaria x ananassa (Strawberry)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY-1LFY-1Fragaria x ananassagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JN788259.1-LFY-1.m1-cds1JN788259.1-LFY-1.m1-cds1Fragaria x ananassaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFY-1JN788259.1-LFY-1.p1Fragaria x ananassapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JN788259 region JN788259:1..1245+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductLEAFY-like protein 1
Genbank noteFaLFY-1
The following sequences are available for this feature:

mRNA sequence

>JN788259.1-LFY-1.m1 ID=JN788259.1-LFY-1.m1|Name=LFY-1|organism=Fragaria x ananassa|type=mRNA|length=1245bp
back to top

protein sequence of LFY-1

>JN788259.1-LFY-1.p1 ID=JN788259.1-LFY-1.p1|Name=LFY-1|organism=Fragaria x ananassa|type=polypeptide|length=414bp
back to top

mRNA from alignment at JN788259:1..1245+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JN788259.1-LFY-1.m1 ID=JN788259.1-LFY-1.m1|Name=LFY-1|organism=Fragaria x ananassa|type=mRNA|length=1245bp|location=Sequence derived from alignment at JN788259:1..1245+ (Fragaria x ananassa)
atggatccaaacgcgttcactgcgagtttgttcaagtgggacctccgtgg catgacggttccgcctaaccggcttcagcttgaggcggcggccgcggccg cagttgctccccaacaagccgcatcggctgctgccgccgcagccgcgggt tactcggtgcgggcgccgagggagattgggggactggaggagatgtcccg ggcttatggagtaaggtactacacggcggcaagaatagcggagctcgggt tcactgtgagcacgcttttggacatgagggatgaggagcttgacgacgtg atgaacagcatgtgtcagtttttccgggtggagctactcgtcggggagag gtacggcatcaagtctgccatccgagctgagaagagacgacttgaggagg aggactcgcggcggcgccacgctctctccggtgacaccaacgctatggat gctctctcacaagaagggctgtcggaggagccggtgcaacaagagaggga gatggtgcggagtggcggaggagcagcatgggaagggggtacggcggcgg agaggcggaagaagctgaggaggattaggagaggtggtgggcataggagt agtaacgagggtattgatggtgatgaggatgaagagaacgatgacggaat caatggaggaggaggggagcgcccgggtagggcattaggtatgaggggtg gtgggagagagagacagagggagcacccattcgtcgtgacggaggctggg gaggtggcacgtggcaaaaagaacggactggattacctcttccatctcta cgagcagtgccatcagtttttgacccaggtgcagaacattgccaaggagc gcggtgaaaaatgtcccaccaaggtcacaaaccaggtgtttagatatgcg aaagaggaaggagcgaactacatcaacaagccgaaaatgcggcactacgt tcactgctacgcgctgcattgtctggacgaggagcgttcaattgcgctga ggcgtgagtgcaagctgcgaggagagaacatcggggcgtggaggcaggcg tgccacaggcctgttgtggaaatagctgcaggccaaggttgggacattga cgccattttcagtgcacatcctcgactatctgtttggtatgttcctacca aacttcgtcagctttgtcacgccgagcgcaacaatgctgctgcctctagc tccgcctcaggtggaagcggtactactgatccgcttccctactga
back to top

Coding sequence (CDS) from alignment at JN788259:1..1245+

>JN788259.1-LFY-1.m1 ID=JN788259.1-LFY-1.m1|Name=LFY-1|organism=Fragaria x ananassa|type=CDS|length=1245bp|location=Sequence derived from alignment at JN788259:1..1245+ (Fragaria x ananassa)
back to top