AMT1.2, JN650607.1-AMT1.2.m1 (mRNA) Pyrus pyrifolia

Transcript Overview
Unique NameJN650607.1-AMT1.2.m1
OrganismPyrus pyrifolia ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
AMT1.2AMT1.2Pyrus pyrifoliagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JN650607.1-AMT1.2.m1-cds1JN650607.1-AMT1.2.m1-cds1Pyrus pyrifoliaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
AMT1.2JN650607.1-AMT1.2.p1Pyrus pyrifoliapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JN650607 region JN650607:1..1515+ NCBI Rosaceae gene and mRNA sequences
scaffold03302 supercontig scaffold03302:11100..12614+ Pyrus communis Genome v1.0 Draft Assembly & Annotation
Property NameValue
Genbank noteammonium transporter
The following sequences are available for this feature:

mRNA sequence

>JN650607.1-AMT1.2.m1 ID=JN650607.1-AMT1.2.m1|Name=AMT1.2|organism=Pyrus pyrifolia|type=mRNA|length=1515bp
back to top

protein sequence of AMT1.2

>JN650607.1-AMT1.2.p1 ID=JN650607.1-AMT1.2.p1|Name=AMT1.2|organism=Pyrus pyrifolia|type=polypeptide|length=504bp
back to top

mRNA from alignment at JN650607:1..1515+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JN650607.1-AMT1.2.m1 ID=JN650607.1-AMT1.2.m1|Name=AMT1.2|organism=Pyrus pyrifolia|type=mRNA|length=1515bp|location=Sequence derived from alignment at JN650607:1..1515+ (Pyrus pyrifolia)
atggccactctgacctgcacagcctccgacttagccccacttctcaccac cgccaccaccgccctcaatgccacagccctctccgaattcctctgcggcc gctttaacacaatctccaccaaattcgctgacaccacttacgcagtcgac aacacttacctcctcttctccgcctaccttgtcttcgccatgcagctcga cttcgccatgctatgcgccggctccgttcgtgccaagaacaccatgaata tcatgctcaccaacgaccttgatgccgctgccggtgccctctcctattac ctcttcggctttgcctttgccttcggcgctccctccaacgccttcatcgg ccgacacttcttcggcctccgagacttcccctctgtatccggaggagact acagcttcttcctttgccaatgggcttttgccatagccgccgctggcatc accagcggctctatcgctgagagaacgcaattcgtcgcttacctcattta ctcttctttcctaaccggttttgtctacccggtcgtgtctcattggtttt ggtccgccgacggatgggccagtccaacccggtccgataacttactattt ggctccggttcaattgattttgccggttcgggtgtggtccacatggttgg aggcatagccggtttatggggcgccgtgatcgaaggcccgagaattggca gatttgatcgaaccggccgatctgtggccttgcggggtcacagcgcatcc ctagtcgttctcggtacgttcttgctttggttcgggtggtacgggttcaa ccccggttcatttctcacgattttgaagagttacggcgatggtggtactt attacggtcaatggagcgccattggtaggacagctgtcgcaacgacattg gctggctgcacagccgctctcactacgttgttcggcaagcgattactggt gggtcattggaacgtgctcgacgtttgtaacggtctgttgggtggttttg ccgcgatcacctccgggtgctcggtggtggaaccgtgggcggcaatcgtg tgcgggttcgtggccgcatgggttttgataggatgcaacaaggtggcgga gaagctaaaatacgatgatccattggaggctgcccagttgcatggtggat gtggagcttgggggctgatattcacagggttgtttgcaacagaaaaatat gtgaatgaggtgtactccggcaggtcagggcgcccgtatgggttgtttat gggtggtggtgggaggctgttggcggcgcaaattgtgcagattttggtgg tggcagggtgggtcagtgctaccatgggcccgctgttctatgggcttcat aagttgaagttattgaggatctcaagggaggatgagactcaagggatgga tatgacaaggcatggtggatttgcttatgtttaccatgatgaagatgatc cgtccattaaacctgagtttatgatgcggagggttgagcctgttaatgat gccagtcctgcataa
back to top

Coding sequence (CDS) from alignment at JN650607:1..1515+

>JN650607.1-AMT1.2.m1 ID=JN650607.1-AMT1.2.m1|Name=AMT1.2|organism=Pyrus pyrifolia|type=CDS|length=1515bp|location=Sequence derived from alignment at JN650607:1..1515+ (Pyrus pyrifolia)
back to top