F3H, HM543570.1-F3H.m1 (mRNA) Prunus persica

Transcript Overview
Unique NameHM543570.1-F3H.m1
OrganismPrunus persica (Peach)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
F3HF3HPrunus persicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM543570.1-F3H.m1-cds1HM543570.1-F3H.m1-cds1Prunus persicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
F3HHM543570.1-F3H.p1Prunus persicapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HM543570 region HM543570:71..1156+ NCBI Rosaceae gene and mRNA sequences
scaffold_7 supercontig scaffold_7:17533085..17534913+ Prunus persica Whole Genome v1.0 Assembly & Annotation
Property NameValue
Productflavanone 3-hydroxylase
Genbank notekey enzyme of phenylalanine metabolic pathway; synthesis of flavonoid substances; role in regulating pigment synthesis
The following sequences are available for this feature:

mRNA sequence

>HM543570.1-F3H.m1 ID=HM543570.1-F3H.m1|Name=F3H|organism=Prunus persica|type=mRNA|length=1086bp
back to top

protein sequence of F3H

>HM543570.1-F3H.p1 ID=HM543570.1-F3H.p1|Name=F3H|organism=Prunus persica|type=polypeptide|length=361bp
back to top

mRNA from alignment at HM543570:71..1156+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM543570.1-F3H.m1 ID=HM543570.1-F3H.m1|Name=F3H|organism=Prunus persica|type=mRNA|length=1086bp|location=Sequence derived from alignment at HM543570:71..1156+ (Prunus persica)
atggctcctgctactactctcacctccatagcaggggagaaaaccctgca acaaaaatttgtccgggacgaagatgagcgccccaaggttgcctacaaca acttcagcaatgaaatcccgatcatttcgcttgccgggatcgacgaggtg gaaggccgccgggctgatatttgcaagaagattgtggaggcttgtgagga ttggggtattttccagattgttgatcatggagttgataccaagctcatct cggaaatgaccggtctcgccagagagttcttcgctctgccctcggaggag aagcttcgttttgacatgtccggcggcaaaaagggtggtttcatcgtctc cagccatttacagggagaagctgtgcaagattggcgcgaaattgtgacat acttctcatacccaatccggcaccgggactattcgaggtggccggacaag ccggaaggatggagagaggtgacacagaagtacagcgacgagctgatggg gctggcatgcaagcttttgggggtgttatcagaagccatgggactggaca cagaggcattgacaaaggcgtgtgtagacatggaccaaaaagttgtggtc aatttctacccaaaatgcccccaacccgacctcacccttggcctgaagcg ccacactgacccaggcacaattacccttttgctccaagaccaggttggtg gcctccaggctaccagggatgatgggaagacgtggatcaccgttcaacca gtggaaggagccttcgtggtcaatcttggggaccatggtcattttctgag caatgggaggttcaagaatgctgatcaccaagcagttgtgaactcaaaca gcagcaggctgtccatagccacattccaaaacccagctcaagaagctaca gtctacccactgagcatcagagagggagagaagcccattctagaggggcc aatcacctacacagagatgtacaagaagaagatgaccaaggaccttgagc ttgccaggctcaaaaagctggccaaggagcaacaattgcaggactcggag aaggagggcaagccaaaggatgatatttttgcttag
back to top

Coding sequence (CDS) from alignment at HM543570:71..1156+

>HM543570.1-F3H.m1 ID=HM543570.1-F3H.m1|Name=F3H|organism=Prunus persica|type=CDS|length=1086bp|location=Sequence derived from alignment at HM543570:71..1156+ (Prunus persica)
back to top