GAPDH, DQ091056.1-GAPDH.m1 (mRNA) Rosa palustris

Transcript Overview
Unique NameDQ091056.1-GAPDH.m1
OrganismRosa palustris ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHDQ091056.1-GAPDHRosa palustrisgene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa palustrisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
DQ091056.1-GAPDH.m1-cds1DQ091056.1-GAPDH.m1-cds1Rosa palustrisCDS
DQ091056.1-GAPDH.m1-cds2DQ091056.1-GAPDH.m1-cds2Rosa palustrisCDS
DQ091056.1-GAPDH.m1-cds3DQ091056.1-GAPDH.m1-cds3Rosa palustrisCDS
DQ091056.1-GAPDH.m1-cds4DQ091056.1-GAPDH.m1-cds4Rosa palustrisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
GAPDHDQ091056.1-GAPDH.p1Rosa palustrispolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
DQ091056 region DQ091056:1..646+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productglyceraldehyde 3-phosphate dehydrogenase
The following sequences are available for this feature:

mRNA sequence

>DQ091056.1-GAPDH.m1 ID=DQ091056.1-GAPDH.m1|Name=GAPDH|organism=Rosa palustris|type=mRNA|length=327bp
back to top

protein sequence of GAPDH

>DQ091056.1-GAPDH.p1 ID=DQ091056.1-GAPDH.p1|Name=GAPDH|organism=Rosa palustris|type=polypeptide|length=108bp
back to top

mRNA from alignment at DQ091056:1..646+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ091056.1-GAPDH.m1 ID=DQ091056.1-GAPDH.m1|Name=GAPDH|organism=Rosa palustris|type=mRNA|length=646bp|location=Sequence derived from alignment at DQ091056:1..646+ (Rosa palustris)
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatact agatttaaaaccaactaaagtcgtctgtgtatttgcaattcagccaccca gaagactgttgatagaccatcagcaaaggactggagaggtggacgtgctg cctcattcaacatcattcccagcagcactggagctgccaaggtattttca atattctttgtgccactgcttcagtattgttgatacacttgtaagttaca tgtcagtgatacttcatttttaacagctttattaatccttgattttggaa tatgtttaggctgttggaaaggttctgcctgctctcaatggcaagttgac cggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca ctgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatc aagtaaggcttgttgaactttgttgttaattagttgcaatcaaggtgggg tgtcatgacattacaatgcatgtcttggttctaatcttttatctttaatt ctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggtt acaccgatgaggatgttgtgtcaactgacttcattggtgacaacag
back to top

Coding sequence (CDS) from alignment at DQ091056:1..646+

>DQ091056.1-GAPDH.m1 ID=DQ091056.1-GAPDH.m1|Name=GAPDH|organism=Rosa palustris|type=CDS|length=327bp|location=Sequence derived from alignment at DQ091056:1..646+ (Rosa palustris)
back to top