C4H, HM204477.1-C4H (gene) Prunus armeniaca

Gene Overview
NameC4H
Unique NameHM204477.1-C4H
Typegene
OrganismPrunus armeniaca (Apricot)
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
C4HC4HPrunus armeniacagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
C4HHM204477.1-C4H.m1Prunus armeniacamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreHM204477.1
Alignments
Feature NameTypeLocationAnalysis
HM204477 region HM204477:103..2856+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>HM204477.1-C4H ID=HM204477.1-C4H|Name=C4H|organism=Prunus armeniaca|type=gene|length=2754bp
atggacctactcctcctggaaaagaccctcctgggtctcttcatcgccgt
catcgtcgcaatcactatttcgaagctccgtggcaagcggttcaagctcc
cgcccggtccgatacccgtaccagttttcggaaactggctccaggtcggc
gacgacctcaatcaccggaacctcaccgacctcgcgaaaaagttcggcga
catcttcctcctccgcatggggcagcgcaatttggtggtggtctcgtccc
ctgacctcgccaaggaggtcctccacacccagggcgtcgaattcgggtcg
aggacacgaaacgtcgtgttcgatattttcaccggtgagggccaggatat
ggtgttcacggtctacggtgagcactggaggaagatgaggcggatcatga
ccgttcctttcttcactaacaaggtcgtgcagcagtataggcacggctgg
gaatcggaggcagcggcggtggttgaggacgtgaagaagtacccggggtc
tgcgaccaatgggatggtgctgcggaggcggttgcagctgatgatgtaca
acaacatgtaccggattatgttcgatcggaggttcgagagcgaggaggat
cctctgtttatgaagctcaaggggttgaatggggagaggagccgattggc
tcagagcttcgattacaattatggagattttatccccattttgagaccct
tcttgagaggctacttgaagatctgcaaagaggtcaaggagaagagaatt
cggctgttcaaggactactttgttgatgaacggaagtaagattttttttt
ttttttacttaattcaattttgttatttatgttgaaaaacattagtgtct
aattagtaaaagataaaaatgaaactgttactggaactctaatttgtcgt
cctgcattgaaaaagaaacgaataagaatgacaaactgatagtgtaaata
agtattactggtcaaatataccacgttagtagcatgagtattatgaatgg
tttccttttttgggtctaatggaaattttttttttccactttcaaaatat
gtgaagttttctatttttatagaatatttgattatatctgaaatgaaatt
tgattttaattgttgagcaggaaactttcaagcacaaaaacgacaacaaa
tgaaggactgaagtgcgccatcgaccatatcctggacgctcagcagaagg
gagagatcaacgaggacaacgtcctttacatcgtcgagaacatcaacgtt
gctggtaagtggggccctcacttccctagtctcctaatttttaccacagc
aacacagtgccatgcatttttactgctttacccaattttttcgagaggtt
attatgggaaatgccaatggcgcttctcttaaaattttcacatgatttat
gcagaacaaacaaaaaataaatcctataaaacttaccgttcataattgca
agcctgcgaaattcggtgcccttgtcgccggtgtttattgtgaggataaa
ttttttgacctgttcttccactcttttattttatattttcttacaaataa
tattacaattaatcctagattttatttaaatcgcaattaaaacattaacg
ggtctagttgagtgaaaaagtgaattgacatgcagattagagggcttaag
ttcgaaccccataatatcttggttacaagacaaaattgattatttcaacg
ccaacttagaactcattttaagtatttaagttattttcaactctatttta
acccaaaccattggttgtcctgcatcgtgacatgattccttttcaggtta
ggtgataaatatttgtttaaatctgaatatgtcaaatccactttattagg
tgcatctaggtgaacaaaacatgtggcttcaatgttaatacatacaacct
agcaactttcttgggtttccttataatgatggaaacatacacatcttatc
ctctacattagttaaacttcattttatgtacaatccactttcttcttgcc
aacccctgtgacattgactgccaactcactttccatttggacactacaga
ttaatcacagtctgatatatgtgcataaactttactctttgtaattttaa
taacgtatctaactcgttacagataatcagagtctaatatattttttttg
attaacagcaattgaaacaacactatggtcaattgagtgggggattgcag
agcttgtgaaccaccctgagatccaaaagaagctgagggatgagcttgac
tcagtgcttggccctggtgttcaaatcacagagccagagatccagaagct
tccctaccttcaagctgtgatcaaagagactctcaggcttcgcatggcaa
tcccattgcttgtcccacacatgaatctcaacgatgcaaagctgggcagc
tacgacattccagcggagagcaagatcctggtgaatgcatggtggctggc
aaacaaccctgccctctggaagaagcctgaggagtttaggccagagaggt
ttttggaggaagaggccaaggttgaggccaatggcaatgactttaggtac
cttccatttggtgttgggagaagaagctgtccagggattattttggccct
tccaattcttgggatcactttgggacgtttagtccagaactttgagctct
tgcctcctcctggacagtccaagcttgacaccacagagaaaggtgggcag
ttcagcttgcacattttgaagcactctaccattgtgttgaagccaaggtc
atag
back to top

gene from alignment at HM204477:103..2856+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM204477.1-C4H ID=HM204477.1-C4H|Name=C4H|organism=Prunus armeniaca|type=gene|length=2754bp|location=Sequence derived from alignment at HM204477:103..2856+ (Prunus armeniaca)
atggacctactcctcctggaaaagaccctcctgggtctcttcatcgccgt catcgtcgcaatcactatttcgaagctccgtggcaagcggttcaagctcc cgcccggtccgatacccgtaccagttttcggaaactggctccaggtcggc gacgacctcaatcaccggaacctcaccgacctcgcgaaaaagttcggcga catcttcctcctccgcatggggcagcgcaatttggtggtggtctcgtccc ctgacctcgccaaggaggtcctccacacccagggcgtcgaattcgggtcg aggacacgaaacgtcgtgttcgatattttcaccggtgagggccaggatat ggtgttcacggtctacggtgagcactggaggaagatgaggcggatcatga ccgttcctttcttcactaacaaggtcgtgcagcagtataggcacggctgg gaatcggaggcagcggcggtggttgaggacgtgaagaagtacccggggtc tgcgaccaatgggatggtgctgcggaggcggttgcagctgatgatgtaca acaacatgtaccggattatgttcgatcggaggttcgagagcgaggaggat cctctgtttatgaagctcaaggggttgaatggggagaggagccgattggc tcagagcttcgattacaattatggagattttatccccattttgagaccct tcttgagaggctacttgaagatctgcaaagaggtcaaggagaagagaatt cggctgttcaaggactactttgttgatgaacggaagtaagattttttttt ttttttacttaattcaattttgttatttatgttgaaaaacattagtgtct aattagtaaaagataaaaatgaaactgttactggaactctaatttgtcgt cctgcattgaaaaagaaacgaataagaatgacaaactgatagtgtaaata agtattactggtcaaatataccacgttagtagcatgagtattatgaatgg tttccttttttgggtctaatggaaattttttttttccactttcaaaatat gtgaagttttctatttttatagaatatttgattatatctgaaatgaaatt tgattttaattgttgagcaggaaactttcaagcacaaaaacgacaacaaa tgaaggactgaagtgcgccatcgaccatatcctggacgctcagcagaagg gagagatcaacgaggacaacgtcctttacatcgtcgagaacatcaacgtt gctggtaagtggggccctcacttccctagtctcctaatttttaccacagc aacacagtgccatgcatttttactgctttacccaattttttcgagaggtt attatgggaaatgccaatggcgcttctcttaaaattttcacatgatttat gcagaacaaacaaaaaataaatcctataaaacttaccgttcataattgca agcctgcgaaattcggtgcccttgtcgccggtgtttattgtgaggataaa ttttttgacctgttcttccactcttttattttatattttcttacaaataa tattacaattaatcctagattttatttaaatcgcaattaaaacattaacg ggtctagttgagtgaaaaagtgaattgacatgcagattagagggcttaag ttcgaaccccataatatcttggttacaagacaaaattgattatttcaacg ccaacttagaactcattttaagtatttaagttattttcaactctatttta acccaaaccattggttgtcctgcatcgtgacatgattccttttcaggtta ggtgataaatatttgtttaaatctgaatatgtcaaatccactttattagg tgcatctaggtgaacaaaacatgtggcttcaatgttaatacatacaacct agcaactttcttgggtttccttataatgatggaaacatacacatcttatc ctctacattagttaaacttcattttatgtacaatccactttcttcttgcc aacccctgtgacattgactgccaactcactttccatttggacactacaga ttaatcacagtctgatatatgtgcataaactttactctttgtaattttaa taacgtatctaactcgttacagataatcagagtctaatatattttttttg attaacagcaattgaaacaacactatggtcaattgagtgggggattgcag agcttgtgaaccaccctgagatccaaaagaagctgagggatgagcttgac tcagtgcttggccctggtgttcaaatcacagagccagagatccagaagct tccctaccttcaagctgtgatcaaagagactctcaggcttcgcatggcaa tcccattgcttgtcccacacatgaatctcaacgatgcaaagctgggcagc tacgacattccagcggagagcaagatcctggtgaatgcatggtggctggc aaacaaccctgccctctggaagaagcctgaggagtttaggccagagaggt ttttggaggaagaggccaaggttgaggccaatggcaatgactttaggtac cttccatttggtgttgggagaagaagctgtccagggattattttggccct tccaattcttgggatcactttgggacgtttagtccagaactttgagctct tgcctcctcctggacagtccaagcttgacaccacagagaaaggtgggcag ttcagcttgcacattttgaagcactctaccattgtgttgaagccaaggtc atag
back to top