LFY, AY555341.1-LFY.m1 (mRNA) Physocarpus capitatus

Transcript Overview
NameLFY
Unique NameAY555341.1-LFY.m1
TypemRNA
OrganismPhysocarpus capitatus ()
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYAY555341.1-LFYPhysocarpus capitatusgene


This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYPhysocarpus capitatusgene


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AY555341.1-LFY.m1-cds1AY555341.1-LFY.m1-cds1Physocarpus capitatusCDS
AY555341.1-LFY.m1-cds2AY555341.1-LFY.m1-cds2Physocarpus capitatusCDS


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYAY555341.1-LFY.p1Physocarpus capitatuspolypeptide


Cross References
External references for this mRNA
DatabaseAccession
GI45453907
nuccoreAY555341.1
Alignments
Feature NameTypeLocationAnalysis
AY555341 region AY555341:1..905+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
ProductLEAFY protein
Sourcegenbank
Sequences
The following sequences are available for this feature:

mRNA sequence

>AY555341.1-LFY.m1 ID=AY555341.1-LFY.m1|Name=LFY|organism=Physocarpus capitatus|type=mRNA|length=57bp
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgcc
aaaaagg
back to top

protein sequence of LFY

>AY555341.1-LFY.p1 ID=AY555341.1-LFY.p1|Name=LFY|organism=Physocarpus capitatus|type=polypeptide|length=18bp
GEKCPTKVTNQVFRYAKK
back to top

mRNA from alignment at AY555341:1..905+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AY555341.1-LFY.m1 ID=AY555341.1-LFY.m1|Name=LFY|organism=Physocarpus capitatus|type=mRNA|length=905bp|location=Sequence derived from alignment at AY555341:1..905+ (Physocarpus capitatus)
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgat attgttagaaacgataatttctactgtggtaaatacttgtaatttacaac ctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcc tgctgacaccttcaatataaatgttttgagctaactgtaggagcccaaat tcacaagaaatcaaaatctttaataggtttgttactaatttaggaacttt gccacttagcactacggtctagtggtatttctcttcacttgtaagtcaga ggtcttagattcaagtctcggcaaatccattgtgtggcttagcctaattc tcactcttttagtgtaaatatcgttgtatttaaaaaaaaaactaatttag gaactttggattcctttggaattacttctatagaatacacttttacctat aaatacttcttttactaaaagcacaacaaaagcactcgggagtgcgtctc caagaaccataaaaatgcgttcattattttaaccaaacactatcagcagc acttgtggatttttgaaagcacttttagccctgtaatataggctctaaat attccaacatttatctaaatttggtttgactggccagatgttagacagtg attgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaa aagtctagacccaattgttagtgcattcgactattattatatccgatagg tgaatgttttcttttttgttctacagtttgaagtgttttttactaacatt aacaactgtcgtaagtactaacggtgcataattattagacggattaagta tcttacttattatatatgcaggtgacaaaccaggtgtttaggtatgccaa aaagg
back to top

Coding sequence (CDS) from alignment at AY555341:1..905+

>AY555341.1-LFY.m1 ID=AY555341.1-LFY.m1|Name=LFY|organism=Physocarpus capitatus|type=CDS|length=57bp|location=Sequence derived from alignment at AY555341:1..905+ (Physocarpus capitatus)
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgcc
aaaaagg
back to top