LFY, AY555338.1-LFY.m1 (mRNA) Physocarpus alternans

Transcript Overview
NameLFY
Unique NameAY555338.1-LFY.m1
TypemRNA
OrganismPhysocarpus alternans ()
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYAY555338.1-LFYPhysocarpus alternansgene


This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYPhysocarpus alternansgene


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AY555338.1-LFY.m1-cds1AY555338.1-LFY.m1-cds1Physocarpus alternansCDS
AY555338.1-LFY.m1-cds2AY555338.1-LFY.m1-cds2Physocarpus alternansCDS


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYAY555338.1-LFY.p1Physocarpus alternanspolypeptide


Cross References
External references for this mRNA
DatabaseAccession
GI45453901
nuccoreAY555338.1
Alignments
Feature NameTypeLocationAnalysis
AY555338 region AY555338:1..902+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
ProductLEAFY protein
Sourcegenbank
Sequences
The following sequences are available for this feature:

mRNA sequence

>AY555338.1-LFY.m1 ID=AY555338.1-LFY.m1|Name=LFY|organism=Physocarpus alternans|type=mRNA|length=57bp
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgcc
aaaaagg
back to top

protein sequence of LFY

>AY555338.1-LFY.p1 ID=AY555338.1-LFY.p1|Name=LFY|organism=Physocarpus alternans|type=polypeptide|length=18bp
GEKCPTKVTNQVFRYAKK
back to top

mRNA from alignment at AY555338:1..902+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AY555338.1-LFY.m1 ID=AY555338.1-LFY.m1|Name=LFY|organism=Physocarpus alternans|type=mRNA|length=902bp|location=Sequence derived from alignment at AY555338:1..902+ (Physocarpus alternans)
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaat attgttagaaacgataatttctactgtggtaaatacttgtaattgacaac ctgatctttgtgggctaattgtaggctagtgggccacaattgaagaggcc tgctgacaccttcaatataaatgtttgagctaactgtaggagcccaaatt cacaagaaatcaaaatctttaataggtttgttactaatttaggaattttg tcacttagcactacggtttagtaggatttttcttcacttgtaagtcagag gtcttaggttcaagtctcggcaagcccattatgtggcttagtctaattct caccctttagtgtaaatatcgttgtatttaaaaaaaaactaatttaggaa ctttggattcctttgggattacttctagagaatacacttttacctataaa tacttcttttagtaaaagcacaacaaaagcactcgggagtgcttctctaa gaaccataaaaatgcgttcattattttaaccaaacactatcagcagcact tgtggatttttgaaagcgcttttagccctgtaaaataggctctaaatatt ccaacatttatctaaatttggtttgactggccagatgttagacagtgatt gatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaag tctagacccaattgttagtgcattcgactattattgtatccgataggtga atgttttcttttttgttctacagtttgtagtgtttttaactaacattaac aactgtcataagtactaacggtgcataattattagacggattaagtatct tacttattatatatgcaggtgacaaaccaggtgtttaggtatgccaaaaa gg
back to top

Coding sequence (CDS) from alignment at AY555338:1..902+

>AY555338.1-LFY.m1 ID=AY555338.1-LFY.m1|Name=LFY|organism=Physocarpus alternans|type=CDS|length=57bp|location=Sequence derived from alignment at AY555338:1..902+ (Physocarpus alternans)
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgcc
aaaaagg
back to top