LFY, AY555332.1-LFY.m1 (mRNA) Physocarpus alternans

Transcript Overview
Unique NameAY555332.1-LFY.m1
OrganismPhysocarpus alternans ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYAY555332.1-LFYPhysocarpus alternansgene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYPhysocarpus alternansgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AY555332.1-LFY.m1-cds1AY555332.1-LFY.m1-cds1Physocarpus alternansCDS
AY555332.1-LFY.m1-cds2AY555332.1-LFY.m1-cds2Physocarpus alternansCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYAY555332.1-LFY.p1Physocarpus alternanspolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AY555332 region AY555332:1..903+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductLEAFY protein
The following sequences are available for this feature:

mRNA sequence

>AY555332.1-LFY.m1 ID=AY555332.1-LFY.m1|Name=LFY|organism=Physocarpus alternans|type=mRNA|length=57bp
back to top

protein sequence of LFY

>AY555332.1-LFY.p1 ID=AY555332.1-LFY.p1|Name=LFY|organism=Physocarpus alternans|type=polypeptide|length=18bp
back to top

mRNA from alignment at AY555332:1..903+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AY555332.1-LFY.m1 ID=AY555332.1-LFY.m1|Name=LFY|organism=Physocarpus alternans|type=mRNA|length=903bp|location=Sequence derived from alignment at AY555332:1..903+ (Physocarpus alternans)
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaat attgttagaaacgataatttctactgtggtaaatacttgtaatttacaac ctgatctttgtgggcccattgtaggctagtgggccacagttgaagaggcc tgctgacaccttcaatataaatgtttgagctaactgtaggagcccaaatt cacaagaaatcaaaatctttaataggtttgttactaatttaggaattttg ccacttagcattacggtttagtaggatttctcttcacttgtaagtcaaag gttttaggttcaagtctcggcaagcccattgtgtggcttagtctaattct cacccctttagtgtaaatatcgttgtatttaaaaaaaaaactaatttagg aactttggattcctttgggattacttctatagaatacacttttacctata aatacttcttttactaaaagcacaacaaaagcactcgggagtgcttctcc aagaaccataaaaatgctttcattcttttaaccaaacactatcagcagca cttgtggatttttgaaagcgcttttagccctgtaaaataggctctaaata ttccaacatttatctaatttggtttgactggccagatgttagacagtgat tgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaa gtctagacccaattgttagtgcattcgactattattgtatccgataggtg aatgtcttcttttttgttctacagtttgaagtgtttttaactaacattaa caactgtcataagtactaacggtgcataattattagacggattaagtatc ttacttattatatatgcaggtgacaaaccaggtgtttaggtatgccaaaa agg
back to top

Coding sequence (CDS) from alignment at AY555332:1..903+

>AY555332.1-LFY.m1 ID=AY555332.1-LFY.m1|Name=LFY|organism=Physocarpus alternans|type=CDS|length=57bp|location=Sequence derived from alignment at AY555332:1..903+ (Physocarpus alternans)
back to top