LFY-1, AB162030.1-LFY-1.m1 (mRNA) Pyrus communis

Transcript Overview
Unique NameAB162030.1-LFY-1.m1
OrganismPyrus communis (European Pear)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY-1LFY-1Pyrus communisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AB162030.1-LFY-1.m1-cds1AB162030.1-LFY-1.m1-cds1Pyrus communisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFY-1AB162030.1-LFY-1.p1Pyrus communispolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AB162030 region AB162030:28..1257+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductLEAFY protein
The following sequences are available for this feature:

mRNA sequence

>AB162030.1-LFY-1.m1 ID=AB162030.1-LFY-1.m1|Name=LFY-1|organism=Pyrus communis|type=mRNA|length=1230bp
back to top

protein sequence of LFY-1

>AB162030.1-LFY-1.p1 ID=AB162030.1-LFY-1.p1|Name=LFY-1|organism=Pyrus communis|type=polypeptide|length=409bp
back to top

mRNA from alignment at AB162030:28..1257+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AB162030.1-LFY-1.m1 ID=AB162030.1-LFY-1.m1|Name=LFY-1|organism=Pyrus communis|type=mRNA|length=1230bp|location=Sequence derived from alignment at AB162030:28..1257+ (Pyrus communis)
atggatccagatgccttctctgcgaacttgttcaagtgggacttacgtgg gatggttgtgccgacgaaccgggttcagctcgaagcggccgtaacgccag cagcggcagctgctgcgggggcggttggttatactttaaggccgccaaga gagcttggacttggagggcttgaagacttgttccaggcttatggggtcag atactacccggcggcgaagatagcggagcttggatttactgtgaacaccc tcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctct cagatattccgctgggagttgcttgttggggagaggtatggtatcaaagc tgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggc gcaaccctgtctctggtgataccaccaccaatgccctagatgctctctcc caagaaggactgtcggaggagccagtgcaacaagagaaggagatggtggg gagcggtgtagggatggcgtgggaggttgtgacggcgggagagaggcgga agaagcagcggaggatgaagaaggggcaatataggaactgtagtgctgta gggggtcataataatgatcataacgagggtgtagacgacaaggacgacga catggacgacatgaatgggcaggggaacggtggaggaggggggttgctag gcgagagacagagggagcacccgttcatcgtgacggagcctggggaggtg gcacgtggcaaaaagaacggtcttgattacctcttccatctctacgagca gtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtg aaaaatgtccaaccaaggtgacaaaccaggtgtttaggtatgccaaaaag tcaggcgcaagctacatcaacaagccgaagatgcggcactatgtgcactg ctacgccctgcattgcctggacgtggaggcatcgaatgtgttgaggagag cgttcaaggagacgggcgaaaatgtcgggtcatggcggcaggcatgttac aagcctcttgtggtcattgcagcgggccaaggctgggacatcgatgccat tttcaattctcatccccgtctttccatctggtacgttcccacgaagctcc gtcagctttgtcacgccgagcgccacaacaccgcctctagctctgcctcc ggtggcgggggcgagcacctgccctattga
back to top

Coding sequence (CDS) from alignment at AB162030:28..1257+

>AB162030.1-LFY-1.m1 ID=AB162030.1-LFY-1.m1|Name=LFY-1|organism=Pyrus communis|type=CDS|length=1230bp|location=Sequence derived from alignment at AB162030:28..1257+ (Pyrus communis)
back to top