LFY, GU991505.1-LFY.m1 (mRNA) Pyrus pyrifolia

Transcript Overview
Unique NameGU991505.1-LFY.m1
OrganismPyrus pyrifolia ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYPyrus pyrifoliagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
GU991505.1-LFY.m1-cds1GU991505.1-LFY.m1-cds1Pyrus pyrifoliaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYGU991505.1-LFY.p1Pyrus pyrifoliapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
GU991505 region GU991505:1..403+ NCBI Rosaceae gene and mRNA sequences
scaffold00514 supercontig scaffold00514:5464..5866+ Pyrus communis Genome v1.0 Draft Assembly & Annotation
Property NameValue
The following sequences are available for this feature:

mRNA sequence

>GU991505.1-LFY.m1 ID=GU991505.1-LFY.m1|Name=LFY|organism=Pyrus pyrifolia|type=mRNA|length=403bp
back to top

protein sequence of LFY

>GU991505.1-LFY.p1 ID=GU991505.1-LFY.p1|Name=LFY|organism=Pyrus pyrifolia|type=polypeptide|length=134bp
back to top

mRNA from alignment at GU991505:1..403+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU991505.1-LFY.m1 ID=GU991505.1-LFY.m1|Name=LFY|organism=Pyrus pyrifolia|type=mRNA|length=403bp|location=Sequence derived from alignment at GU991505:1..403+ (Pyrus pyrifolia)
tgtcggaggagccagtgcaacaagagaaggagatggtagggagcggagga ggggcggcgtgggaggttgcaacggcaggggagaggcggaagaagcagcg gaggatgaagaaggggcaatttaaaaattgtagcgctggagggcgtcata ataacgagggtgtggacgacgaggacgacaacgacatggacgacatgact gggtatgggaacggtggaggagggggaatgctgggagagagacagaggga gcacccgttcattgtgacggagcctggggaggtggcgcgtggcaaaaaga acggcctcgattacctcttccatctctacgagcaatgccgcgatttcttg atccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaa ggt
back to top

Coding sequence (CDS) from alignment at GU991505:1..403+

>GU991505.1-LFY.m1 ID=GU991505.1-LFY.m1|Name=LFY|organism=Pyrus pyrifolia|type=CDS|length=403bp|location=Sequence derived from alignment at GU991505:1..403+ (Pyrus pyrifolia)
back to top