LFY1, GU991426.1-LFY1.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameGU991426.1-LFY1.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY1GU991426.1-LFY1Malus x domesticagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY1LFY1Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
GU991426.1-LFY1.m1-cds1GU991426.1-LFY1.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFY1GU991426.1-LFY1.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
GU991426 region GU991426:1..407+ NCBI Rosaceae gene and mRNA sequences
Chr06 chromosome Chr06:27319211..27319617+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr11 chromosome chr11:20415789..20416197+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr11 chromosome chr11:23583173..23583581- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
ProductLEAFY 1
The following sequences are available for this feature:

mRNA sequence

>GU991426.1-LFY1.m1 ID=GU991426.1-LFY1.m1|Name=LFY1|organism=Malus x domestica|type=mRNA|length=407bp
back to top

protein sequence of LFY1

>GU991426.1-LFY1.p1 ID=GU991426.1-LFY1.p1|Name=LFY1|organism=Malus x domestica|type=polypeptide|length=135bp
back to top

mRNA from alignment at GU991426:1..407+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU991426.1-LFY1.m1 ID=GU991426.1-LFY1.m1|Name=LFY1|organism=Malus x domestica|type=mRNA|length=407bp|location=Sequence derived from alignment at GU991426:1..407+ (Malus x domestica)
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagta gggatggcgtgggaggttgtgacggcggggcagaggcggaagaagcagcg gaggatgaagaaggggcaatataggaactgtagtgctggagggggtcatg ataatgatcatgacgagggtgtagacgacaaggacgacgacatggacaac atgaatgggcaggggaacggtggaggaggggggttgctaggcgagagaca gagggagcacccgttcattgtgacggagcctggggaggtggcacgtggca aaaagaacggtcttgattacctcttctatctctacgagctgtgccgtgat ttcttgatccaggtccagaacattgccaaggggcgcggtgaaaaatgtcc aaccaag
back to top

Coding sequence (CDS) from alignment at GU991426:1..407+

>GU991426.1-LFY1.m1 ID=GU991426.1-LFY1.m1|Name=LFY1|organism=Malus x domestica|type=CDS|length=407bp|location=Sequence derived from alignment at GU991426:1..407+ (Malus x domestica)
back to top