LFY1, GU991419.1-LFY1.m1 (mRNA) Pyrus serrulata

Transcript Overview
Unique NameGU991419.1-LFY1.m1
OrganismPyrus serrulata ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY1GU991419.1-LFY1Pyrus serrulatagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY1LFY1Pyrus serrulatagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
GU991419.1-LFY1.m1-cds1GU991419.1-LFY1.m1-cds1Pyrus serrulataCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFY1GU991419.1-LFY1.p1Pyrus serrulatapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
GU991419 region GU991419:1..395+ NCBI Rosaceae gene and mRNA sequences
scaffold00563 supercontig scaffold00563:9165..9571- Pyrus communis Genome v1.0 Draft Assembly & Annotation
Property NameValue
ProductLEAFY 1
The following sequences are available for this feature:

mRNA sequence

>GU991419.1-LFY1.m1 ID=GU991419.1-LFY1.m1|Name=LFY1|organism=Pyrus serrulata|type=mRNA|length=395bp
back to top

protein sequence of LFY1

>GU991419.1-LFY1.p1 ID=GU991419.1-LFY1.p1|Name=LFY1|organism=Pyrus serrulata|type=polypeptide|length=131bp
back to top

mRNA from alignment at GU991419:1..395+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU991419.1-LFY1.m1 ID=GU991419.1-LFY1.m1|Name=LFY1|organism=Pyrus serrulata|type=mRNA|length=395bp|location=Sequence derived from alignment at GU991419:1..395+ (Pyrus serrulata)
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagta gggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcg gaggatgaagaagggccaatataggaactgtagtgctggagggggtcata ataatgatcataacgagggtgtagacgacaaggacgacatgaatgggcag gggaacggtggaggaggggggttgctaggcgagagacagagggagcaccc gttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtc ttgattacctcttccatctctacgagcagtgccgtgatttcttgatccag gtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top

Coding sequence (CDS) from alignment at GU991419:1..395+

>GU991419.1-LFY1.m1 ID=GU991419.1-LFY1.m1|Name=LFY1|organism=Pyrus serrulata|type=CDS|length=395bp|location=Sequence derived from alignment at GU991419:1..395+ (Pyrus serrulata)
back to top