ACO1, HQ992772.1-ACO1.m1 (mRNA) Eriobotrya japonica

Transcript Overview
Unique NameHQ992772.1-ACO1.m1
OrganismEriobotrya japonica ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ACO1ACO1Eriobotrya japonicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HQ992772.1-ACO1.m1-cds1HQ992772.1-ACO1.m1-cds1Eriobotrya japonicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ACO1HQ992772.1-ACO1.p1Eriobotrya japonicapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HQ992772 region HQ992772:1..845+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Product1-aminocyclopropane-1-carboxylic acid oxidase
The following sequences are available for this feature:

mRNA sequence

>HQ992772.1-ACO1.m1 ID=HQ992772.1-ACO1.m1|Name=ACO1|organism=Eriobotrya japonica|type=mRNA|length=845bp
back to top

protein sequence of ACO1

>HQ992772.1-ACO1.p1 ID=HQ992772.1-ACO1.p1|Name=ACO1|organism=Eriobotrya japonica|type=polypeptide|length=280bp
back to top

mRNA from alignment at HQ992772:1..845+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HQ992772.1-ACO1.m1 ID=HQ992772.1-ACO1.m1|Name=ACO1|organism=Eriobotrya japonica|type=mRNA|length=845bp|location=Sequence derived from alignment at HQ992772:1..845+ (Eriobotrya japonica)
ttgagttggtgagtcatgggatatctactgagcttttggacactctggag aagatgaccaaggatcactacaagaagaccatggagcaaaggtttaagga aatggtggcagccaaaggcctcgacgctgtccagtccgaaatccacgact tggactgggaaagcaccttctccttgcgccaccttccttcctcaaacatt tccgaaatccctgatctcgaggaagactacaggaagaccatgaaagaatt tgcagtggaactggagaagctagctgagaagcttttggacttgctctgtg agaatcttggactcgagaaggactatctgaagaaggttttctatggatcc aagggtccgaattttgggaccaaggtcagcaactaccctccgtgccccaa gccagacctgatcaagggactccgggcccacagcgacgccggtggcctca tcctgcttttccaggatgacaaggtcagcggcctccagcttctcaaggat ggtgaatgggtggatgtccccccaatgcaccactccattgtcataaactt aggtgaccagattgaggtgatcaccaatgggaagtacagaagtgcgatgc accgggtgatagctcagtcggacgggaccagaatgtcgatagcctcgttc tacaacccaggcgacgatgcatttatcagcccagcaccggcagtgcttga gaagaaaactgaggacgccccaacttatcccaagtttgtgtttgatgact acatgaagctgtattctggcctgaaattccaagccaaggagccaagattt gaagctatgaaggccaaggaatccacccctgttgcaactgcctga
back to top

Coding sequence (CDS) from alignment at HQ992772:1..845+

>HQ992772.1-ACO1.m1 ID=HQ992772.1-ACO1.m1|Name=ACO1|organism=Eriobotrya japonica|type=CDS|length=845bp|location=Sequence derived from alignment at HQ992772:1..845+ (Eriobotrya japonica)
back to top