RPL20, JX118141.1-RPL20 (gene) Fragaria vesca subsp. vesca

Gene Overview
NameRPL20
Unique NameJX118141.1-RPL20
Typegene
OrganismFragaria vesca subsp. vesca ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
RPL20RPL20Fragaria vesca subsp. vescagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
RPL20JX118141.1-RPL20.m1Fragaria vesca subsp. vescamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreJX118141.1
Alignments
Feature NameTypeLocationAnalysis
JX118141 region JX118141:1..319- NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>JX118141.1-RPL20 ID=JX118141.1-RPL20|Name=RPL20|organism=Fragaria vesca subsp. vesca|type=gene|length=319bp
atgaccagaattaaacgagggtatatagctcgaagacgtagaacaaaaat
ccgtttatttgcatcaacttttcgaggggctcattcaagacttactcgga
ctattactcaacagaaaataagagctttggtttcggctcatcgggatagg
agtagacaaaagagagattttcgtcggttgtggatcactcgtataaatgc
agtaattcgagataataaagtatactttagttattgtaaattaatacaca
atctgtacaagaaacagttgcttcttaatcgtaaaatacttgcacaaata
gctatattaaataagagtt
back to top

gene from alignment at JX118141:1..319-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>JX118141.1-RPL20 ID=JX118141.1-RPL20|Name=RPL20|organism=Fragaria vesca subsp. vesca|type=gene|length=319bp|location=Sequence derived from alignment at JX118141:1..319- (Fragaria vesca subsp. vesca)
ATGACCAGAATTAAACGAGGGTATATAGCTCGAAGACGTAGAACAAAAAT CCGTTTATTTGCATCAACTTTTCGAGGGGCTCATTCAAGACTTACTCGGA CTATTACTCAACAGAAAATAAGAGCTTTGGTTTCGGCTCATCGGGATAGG AGTAGACAAAAGAGAGATTTTCGTCGGTTGTGGATCACTCGTATAAATGC AGTAATTCGAGATAATAAAGTATACTTTAGTTATTGTAAATTAATACACA ATCTGTACAAGAAACAGTTGCTTCTTAATCGTAAAATACTTGCACAAATA GCTATATTAAATAAGAGTT
back to top