C4H, HQ901370.1-C4H.m1 (mRNA) Pyrus x bretschneideri

Transcript Overview
Unique NameHQ901370.1-C4H.m1
OrganismPyrus x bretschneideri ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
C4HC4HPyrus x bretschneiderigene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HQ901370.1-C4H.m1-cds1HQ901370.1-C4H.m1-cds1Pyrus x bretschneideriCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
C4HHQ901370.1-C4H.p1Pyrus x bretschneideripolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HQ901370 region HQ901370:85..1599+ NCBI Rosaceae gene and mRNA sequences
scaffold00442 supercontig scaffold00442:28348..32677+ Pyrus communis Genome v1.0 Draft Assembly & Annotation
Property NameValue
Productcinnamic acid 4-hydroxylase-like protein
Genbank notesimilar to INSD ABD77493.2 cinnamic acid 4-hydroxylase [Arnebia euchroma]
The following sequences are available for this feature:

mRNA sequence

>HQ901370.1-C4H.m1 ID=HQ901370.1-C4H.m1|Name=C4H|organism=Pyrus x bretschneideri|type=mRNA|length=1515bp
back to top

protein sequence of C4H

>HQ901370.1-C4H.p1 ID=HQ901370.1-C4H.p1|Name=C4H|organism=Pyrus x bretschneideri|type=polypeptide|length=504bp
back to top

mRNA from alignment at HQ901370:85..1599+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HQ901370.1-C4H.m1 ID=HQ901370.1-C4H.m1|Name=C4H|organism=Pyrus x bretschneideri|type=mRNA|length=1515bp|location=Sequence derived from alignment at HQ901370:85..1599+ (Pyrus x bretschneideri)
atggacctcctcttcctggaaaagacccttctgggtctcttcgtcgcggt catcgttgccatcaccatttcaaaactccgcggcaagaaattcaggctcc cgccgggtcccatccccgtacccgtattcggaaactggctccaggtcggt gacggcctcaaccaccgcaatctcaccgacatggccaagaaattcggcga ctgcttcctcctccgcatggggcagcgcaacctcgtcgtcgtctcctcgc cggagctcgccaaggaggtcctccacactcagggagtcgaattcgggtcg aggacccgaaacgtcgtctttgatattttcaccggtgaaggccaggacat ggtgttcaccgtctacggcgagcactggcggaaaatgcggcgtatcatga ccgtccccttcttcaccaacaaggtcgtccagcagtaccgctacggatgg gagtcggaggcggcggcggtcgtcgaggatgtgaaaaagcaccccgaggc ggcgaccagcggaatggtgctgcggaggcggctgcagctgatgatgtaca acaacatgtacagaatcatgttcgaccggcgattcgagagcgaggaggat cccctgttcgtgaagctcaaggcgctgaatggggagaggaaccgattggc gcagagcttcgactacaactacggtgattttatcccgatcttaaggccct ttttgagagggtatttgaagatctgcaaggaagtggaggagaagaggatc cagctgtttaaggactatttcgtggacgagaggaagaaactttcgagcac aaagcctacaacaaacgaagggttgaaatgcgccatcgaccacatcctcg acgcgcagcagaaaggagaaatcaacgaggacaacgttctctacatcgtc gagaacatcaacgttgctgctattgaaaccacattgtggtcgatcgagtg gggaattgccgagctagtgaaccatcccgaaatccagaagaagctgagga atgaactcgacacagtccttggccgcggagttcagatcacagagcccgac gttcataaacttccctacctgcaagccgtggtcaaggagactctccgact tcgcatggcaatcccactccttgtcccccacatgaacctccaggatgcca agctcggtgggtttgatattccggcggagagcaagatactggtgaatgct tggtggttggcaaacaaccctgccctgtggaagaagccagaagagtttag gcccgagaggtttttggaggaggagtcgaaggtggaggctaacgggaacg acttcaggtatctcccgtttggtgttgggaggagaagttgtcctgggatt attttggccctgccaatcctgggcattacaattggacgtttagtccagaa cttcgagcttctgcctccgccgggacagtccaagctcgacacctcggaga aaggtgggcagttcagcctgcacatcctgaagcattccaccattgtgatg aagtcgagggcgtag
back to top

Coding sequence (CDS) from alignment at HQ901370:85..1599+

>HQ901370.1-C4H.m1 ID=HQ901370.1-C4H.m1|Name=C4H|organism=Pyrus x bretschneideri|type=CDS|length=1515bp|location=Sequence derived from alignment at HQ901370:85..1599+ (Pyrus x bretschneideri)
back to top