IPT7A, HQ585953.1-IPT7A.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameHQ585953.1-IPT7A.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
IPT7AIPT7AMalus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HQ585953.1-IPT7A.m1-cds1HQ585953.1-IPT7A.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
IPT7AHQ585953.1-IPT7A.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HQ585953 region HQ585953:1..855+ NCBI Rosaceae gene and mRNA sequences
Chr00 chromosome Chr00:16949199..16950053- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr6 chromosome chr6:5106680..5107534- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr6 chromosome chr6:7224282..7225136- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr6 chromosome chr6:5896278..5897132- Malus x domestica Whole Genome v1.0p Assembly & Annotation
chr6 chromosome chr6:8409211..8410065- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
Productadenylate isopentenyltransferase
Genbank notecytokinin biosynthesis enzyme
The following sequences are available for this feature:

mRNA sequence

>HQ585953.1-IPT7A.m1 ID=HQ585953.1-IPT7A.m1|Name=IPT7A|organism=Malus x domestica|type=mRNA|length=855bp
back to top

protein sequence of IPT7A

>HQ585953.1-IPT7A.p1 ID=HQ585953.1-IPT7A.p1|Name=IPT7A|organism=Malus x domestica|type=polypeptide|length=284bp
back to top

mRNA from alignment at HQ585953:1..855+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HQ585953.1-IPT7A.m1 ID=HQ585953.1-IPT7A.m1|Name=IPT7A|organism=Malus x domestica|type=mRNA|length=855bp|location=Sequence derived from alignment at HQ585953:1..855+ (Malus x domestica)
atggaacctgtgcatgtcaatggttctgtccacaaaaaggcgaaggttgt ttttataatgggtccgactgggtgtggaaaaaccaaactttccatagacc tagctaccaattacgggggagaagtaattaattcggacaaaatccaagtc tacaaaggcctggacattgtcactaacaaagccacagaatctgagcaacg aggcatccgtcatcacttgctagggttcgtagaagaccccgtagctgatt tctccgttgatgaatttcgtcgtcgtgtgcaaacttcaatcgatgagatc acaaagcgtaactgcctcccaatcattgctggcggatccaactcttatat cgaggcactcatcgaagatccagtgattgattttcgaaataaatatgatt gctgttttatatggcttgatgtgtcgttgcctgtgctatataaccatgtg tccaaaagagttgacgaaatggtggctgcaggattagtggatgagcttcg tgaaatgtttgctccaggggtgaattatgatggtggcattcgccgagcaa tcggagctccggagatgcatccgtacttcatggctgaaatgaacaacaat atagtagacgatgacaaggttcgtaaggaatttctgctgaaagatggcat ttggaaaaccaaagaaaatacttgtaaacttgctgaacgccaagtgcaga aaattaaacttctcagcgacaaatgggatattcatcgtattgatgtcact gctgtgtatgagaactgtggaaaggaagctgtggttgcctgggaaacctt ggttttaaagccaagtttcaccattgtgggtggatttttgaagaaacatg gttga
back to top

Coding sequence (CDS) from alignment at HQ585953:1..855+

>HQ585953.1-IPT7A.m1 ID=HQ585953.1-IPT7A.m1|Name=IPT7A|organism=Malus x domestica|type=CDS|length=855bp|location=Sequence derived from alignment at HQ585953:1..855+ (Malus x domestica)
back to top