IPT1B, HQ585952.1-IPT1B.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameHQ585952.1-IPT1B.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
IPT1BIPT1BMalus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HQ585952.1-IPT1B.m1-cds1HQ585952.1-IPT1B.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
IPT1BHQ585952.1-IPT1B.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HQ585952 region HQ585952:1..1113+ NCBI Rosaceae gene and mRNA sequences
Chr16 chromosome Chr16:2935618..2936730- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr16 chromosome chr16:1116899..1118011- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr16 chromosome chr16:1116900..1118012- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
Productadenylate isopentenyltransferase
Genbank notecytokinin biosynthesis enzyme
The following sequences are available for this feature:

mRNA sequence

>HQ585952.1-IPT1B.m1 ID=HQ585952.1-IPT1B.m1|Name=IPT1B|organism=Malus x domestica|type=mRNA|length=1113bp
back to top

protein sequence of IPT1B

>HQ585952.1-IPT1B.p1 ID=HQ585952.1-IPT1B.p1|Name=IPT1B|organism=Malus x domestica|type=polypeptide|length=370bp
back to top

mRNA from alignment at HQ585952:1..1113+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HQ585952.1-IPT1B.m1 ID=HQ585952.1-IPT1B.m1|Name=IPT1B|organism=Malus x domestica|type=mRNA|length=1113bp|location=Sequence derived from alignment at HQ585952:1..1113+ (Malus x domestica)
atgacacttcatcccttcccaactcactccctccattattccaatttcaa tttcaatacgaattatatctcccaccgtttccacttgctcccgcagctcc accacctctacaaccaccccactcatccgcttcacctcccccaaaggccc cgccgctgggcccacatggccaccggccacacttccgcggtcccacgtcg aaaagacaagctcctcgtcatcatgggggccactggcgccggcaagtccc gcctctccctcgacctcgccacccgcttccccttcttcgaaatcatcaac tccgacaaaatacaactctaccgcggcctcgacatcaccaccaacaagct ccccctcccggaacgactcggcgttccccaccacctcctcggcgagttgg acccccgagacggagatttcacgcccgccgattttcgcgccgtcgccggt caggttgtttccggcattacgaatcggaggaaggtgccgatgctcgtcgg cgggtcaaactccttcattcacgcgatggtcgcggaccgtttcgaaccgg ggtgcaatgtcttcgaaccgggttcagacgcctccctctcggccgagctc agatacaattgctgttttctgtgggtggacgtgtcgatggcggtgttgac agagtatctatcgaagcgagtcgacgaaatgctcgactcgggaatgttcg aggagttggccgagttttgcgacccggatcgccaggacaagcacgacccg gcagcggttccgaccgggctgagaaaggcgattggagtgcccgagttcac tcggtattttaaaaaatacccacaaagtaaaagggacgaggacgatgatc gggagcggagaggagcatacgaagaggcggtaagggcgatcaaggacaac acgtgtcagctggcgaagaggcagatagggaaggtcctacgtttgagagg gggagggtgggacctacggagactagacgcaacggacgcgtttagggcgg tggttgcgacgacatcgtcggatagtgacggcggagagaggtggtcagat atatgggagagacaggtggtgggaccaagcgtgaagattgtgaagcgctt cttggaggagtag
back to top

Coding sequence (CDS) from alignment at HQ585952:1..1113+

>HQ585952.1-IPT1B.m1 ID=HQ585952.1-IPT1B.m1|Name=IPT1B|organism=Malus x domestica|type=CDS|length=1113bp|location=Sequence derived from alignment at HQ585952:1..1113+ (Malus x domestica)
back to top