IPT3A, HQ606061.1-IPT3A.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameHQ606061.1-IPT3A.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
IPT3AIPT3AMalus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HQ606061.1-IPT3A.m1-cds1HQ606061.1-IPT3A.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
IPT3AHQ606061.1-IPT3A.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HQ606061 region HQ606061:1..963+ NCBI Rosaceae gene and mRNA sequences
Chr03 chromosome Chr03:35283549..35284511+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr3 chromosome chr3:31482982..31483944- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr3 chromosome chr3:37001355..37002317+ Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
Productadenylate isopentenyltransferase
Genbank notecytokinin biosynthesis enzyme
The following sequences are available for this feature:

mRNA sequence

>HQ606061.1-IPT3A.m1 ID=HQ606061.1-IPT3A.m1|Name=IPT3A|organism=Malus x domestica|type=mRNA|length=963bp
back to top

protein sequence of IPT3A

>HQ606061.1-IPT3A.p1 ID=HQ606061.1-IPT3A.p1|Name=IPT3A|organism=Malus x domestica|type=polypeptide|length=320bp
back to top

mRNA from alignment at HQ606061:1..963+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HQ606061.1-IPT3A.m1 ID=HQ606061.1-IPT3A.m1|Name=IPT3A|organism=Malus x domestica|type=mRNA|length=963bp|location=Sequence derived from alignment at HQ606061:1..963+ (Malus x domestica)
atgatgccaatgtgcaaacaaatacaaacattacaacatgttccatctag tggccataatcataaaatcgacgtgttcaatcctcaccggcagaaggaga aggtggtgatcgtaatgggagcaacagggaccggaaagtcaaggctctcc atcgacctagccacctgtttcccggcagaaatcataaactccgacaaaat gcaagtctacgaaggccttgacatagtcaccaacaaaataaccaaagaag agcaacgtggtgtaccgcaccatttgctagggatgctagatcctcatgaa gattttactgccagggatttttgtgacctaacctcaattgccattgaatc cattttaggccgtgatcggcttccaatcatcgttggaggttccaactctt acatcgaggcgttgatcgatgattatgactataaatttcggtccaagtat gactgttgctttttatgggtagatgtgtctacacccgttctgcactcttt tgtgtcaaaacgggtagaccacatggttcacaacggaatggtggatgagg cgagagagtactttgatcccaatgcagattacacgaaagggattcgaaga gcaataggggtccctgaattcgataagtacttcaggtatgggccattttt ggatgaagaaactcgtactcggttactacgacaagcagtggacgaaatta aggacaatacgtgcaaattggcatgtcgacaactggagaagattcataga cttagaaatatcaaagggtggaatctgcacccgttggatgccacggaggt gttccgaaagcgcggcgaagaggccgacgaggcctggaaaaagcttgtgt cggggacaagtgctatgatcgttggccagtttctttacaatatgacagct gaggttcctccacatcttggaagccttagggttcttgaagcacttgcagc tgcaactcactag
back to top

Coding sequence (CDS) from alignment at HQ606061:1..963+

>HQ606061.1-IPT3A.m1 ID=HQ606061.1-IPT3A.m1|Name=IPT3A|organism=Malus x domestica|type=CDS|length=963bp|location=Sequence derived from alignment at HQ606061:1..963+ (Malus x domestica)
back to top