ACO1, GU380294.1-ACO1.m1 (mRNA) Prunus avium

Transcript Overview
Unique NameGU380294.1-ACO1.m1
OrganismPrunus avium ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ACO1ACO1Prunus aviumgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
GU380294.1-ACO1.m1-cds1GU380294.1-ACO1.m1-cds1Prunus aviumCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ACO1GU380294.1-ACO1.p1Prunus aviumpolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
GU380294 region GU380294:1..355+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductACC oxidase
The following sequences are available for this feature:

mRNA sequence

>GU380294.1-ACO1.m1 ID=GU380294.1-ACO1.m1|Name=ACO1|organism=Prunus avium|type=mRNA|length=355bp
back to top

protein sequence of ACO1

>GU380294.1-ACO1.p1 ID=GU380294.1-ACO1.p1|Name=ACO1|organism=Prunus avium|type=polypeptide|length=118bp
back to top

mRNA from alignment at GU380294:1..355+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU380294.1-ACO1.m1 ID=GU380294.1-ACO1.m1|Name=ACO1|organism=Prunus avium|type=mRNA|length=355bp|location=Sequence derived from alignment at GU380294:1..355+ (Prunus avium)
tggcatcatccttctattccaagatgacaaagtcagtggtctccaactac tcaaagatgacaaatggattgatgttccaccgatgcgccactccattgtc atcaacctcggtgaccaactcgaggtgattactaatggaaaatacaagag tgtggagcacagggtgattgctcagcctgatggaaacagaatgtccttgg cttcgttctacaatccggggagtgatgctgtcatctatccagcaccagaa ttgctggagaaggaagaaaaagagaacacaataatgtatcccaaatttgt ttttgaggattatatgaaattatatgcaggtctcaaattccaagctaaag agcca
back to top

Coding sequence (CDS) from alignment at GU380294:1..355+

>GU380294.1-ACO1.m1 ID=GU380294.1-ACO1.m1|Name=ACO1|organism=Prunus avium|type=CDS|length=355bp|location=Sequence derived from alignment at GU380294:1..355+ (Prunus avium)
back to top