CBF, JX464668.1-CBF (gene) Prunus persica

Gene Overview
NameCBF
Unique NameJX464668.1-CBF
Typegene
OrganismPrunus persica (Peach)
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CBFCBFPrunus persicagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
CBFJX464668.1-CBF.m1Prunus persicamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreJX464668.1
Alignments
Feature NameTypeLocationAnalysis
JX464668 region JX464668:78..797+ NCBI Rosaceae gene and mRNA sequences
scaffold_5 supercontig scaffold_5:10051648..10052367- Prunus persica Whole Genome v1.0 Assembly & Annotation
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>JX464668.1-CBF ID=JX464668.1-CBF|Name=CBF|organism=Prunus persica|type=gene|length=720bp
atggtcatggacatgatcttcgctcaggtttctgactcggccgaccagcc
caggtcgagttcgtcatccgacgcaagcgtgagcaccttacgcacttcgg
acgtcatactggcgtcgagcagtccgaagaagcgcgcgggaaggaaggtt
ttcaaagagacgaggcacccggtttataggggtgtgaggaggagagacaa
caacaagtgggtgtgtgagttgagacagcccaacaagaagaagtccggga
tttggctcgggacctatcctacggctgagatggctgctcgtgcccatgac
gtggcggcattggcttttaaagggaagcttgcctgcctcaactttgctga
ctcgggttggcggctgccggtcgcggcatccatggattccatggatatcc
agagggcagctgcggaggccgctgaagggttcagaccggtggagttcggt
ggggtttccagcggcagcagtgatgagaaggagagaatggttgtggtgga
agagaagaagaagaagcaggctattgtggatatgggaaaaagctgcagca
gattaaacttgttttatttggatgaggaggaaatgtttgatatgccaagg
ttgattgacaacatggctgaagggcttcttctttctccaccccaatgctt
agctggctatttgaattgggatgacatggaaactgaagctgattccaagt
tgtggagtttctctatctga
back to top

gene from alignment at JX464668:78..797+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>JX464668.1-CBF ID=JX464668.1-CBF|Name=CBF|organism=Prunus persica|type=gene|length=720bp|location=Sequence derived from alignment at JX464668:78..797+ (Prunus persica)
atggtcatggacatgatcttcgctcaggtttctgactcggccgaccagcc caggtcgagttcgtcatccgacgcaagcgtgagcaccttacgcacttcgg acgtcatactggcgtcgagcagtccgaagaagcgcgcgggaaggaaggtt ttcaaagagacgaggcacccggtttataggggtgtgaggaggagagacaa caacaagtgggtgtgtgagttgagacagcccaacaagaagaagtccggga tttggctcgggacctatcctacggctgagatggctgctcgtgcccatgac gtggcggcattggcttttaaagggaagcttgcctgcctcaactttgctga ctcgggttggcggctgccggtcgcggcatccatggattccatggatatcc agagggcagctgcggaggccgctgaagggttcagaccggtggagttcggt ggggtttccagcggcagcagtgatgagaaggagagaatggttgtggtgga agagaagaagaagaagcaggctattgtggatatgggaaaaagctgcagca gattaaacttgttttatttggatgaggaggaaatgtttgatatgccaagg ttgattgacaacatggctgaagggcttcttctttctccaccccaatgctt agctggctatttgaattgggatgacatggaaactgaagctgattccaagt tgtggagtttctctatctga
back to top