S3-RNase, AB537563.1-S3-RNase.m1 (mRNA) Prunus persica

Transcript Overview
Unique NameAB537563.1-S3-RNase.m1
OrganismPrunus persica (Peach)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
S3-RNaseAB537563.1-S3-RNasePrunus persicagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
S3-RNaseS3-RNasePrunus persicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AB537563.1-S3-RNase.m1-cds1AB537563.1-S3-RNase.m1-cds1Prunus persicaCDS
AB537563.1-S3-RNase.m1-cds2AB537563.1-S3-RNase.m1-cds2Prunus persicaCDS
AB537563.1-S3-RNase.m1-cds3AB537563.1-S3-RNase.m1-cds3Prunus persicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
S3-RNaseAB537563.1-S3-RNase.p1Prunus persicapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AB537563 region AB537563:314..1510+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductS-ribonuclease 3
The following sequences are available for this feature:

mRNA sequence

>AB537563.1-S3-RNase.m1 ID=AB537563.1-S3-RNase.m1|Name=S3-RNase|organism=Prunus persica|type=mRNA|length=687bp
back to top

protein sequence of S3-RNase

>AB537563.1-S3-RNase.p1 ID=AB537563.1-S3-RNase.p1|Name=S3-RNase|organism=Prunus persica|type=polypeptide|length=228bp
back to top

mRNA from alignment at AB537563:314..1510+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AB537563.1-S3-RNase.m1 ID=AB537563.1-S3-RNase.m1|Name=S3-RNase|organism=Prunus persica|type=mRNA|length=1197bp|location=Sequence derived from alignment at AB537563:314..1510+ (Prunus persica)
atggggatgctgaaattgtcactcgctttccttgttcttgcttttgcttt cttcttgtgtttcattatgagcgctggtgatggtgggttgcgttacaatc gtttgctctatatatctacatgcatataatcagcattgcttttttctact cgtattttttgttcagggaaactattgtgtgtattcgatgatatatcaca tgacatgcggtgtattgcattcacccacatatttatcatttaatctaacg cacaactttctttggataagtaagtattggggattgcttttctgcatgtc ctctttttatttgcatccctttttttttattctgataattgttgcaataa gcgtagcctattcatcacaataattttggcaggatcttacaactattttc aatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcga ccttgctccaacccccggccattacaatatttcaccatccatggcctatg gccaagtaattattcaaacccaacgaagcccagtaattgcaatgggtcaa aatttgaggacaggaaagtggtatgtattgtttcattatttttttactta ctctttagttggaaaagtggaccgccaggcacgtatatttacaataatga atctgatcatctaatcaaaggatcaaaattcaagattcaatatttaatga aaaaaaacaaaaacaatctcatccaaaaatgaaagtctatttttttctaa aaatatgtatatattgcttggatgtctcagtaccctaaattgcgagccaa actgaagaaatcttggccggacgtggaaagcggtaatgatacaagatttt gggaaggcgaatggaacaaacatggtacatgttccgaacagacacttaac caaatgcaatacttcgagagatcccacgcattttggaacatgcgcaatat tacagaaatccttaaaaacgcttcaatcgtaccaagtgcgacacagacgt ggagctacgcggacatagtatcacctattaaagcagtaactcaaaaaaca cccctccttcgttgcaaaagtaatccagcaactaatactgagttgttaca tgaagtggtattttgttatgaatataatgccttaaagctgattgactgta atcgaacagcaggatgcaaaaatcaacaacgcatctcgtttcaataa
back to top

Coding sequence (CDS) from alignment at AB537563:314..1510+

>AB537563.1-S3-RNase.m1 ID=AB537563.1-S3-RNase.m1|Name=S3-RNase|organism=Prunus persica|type=CDS|length=687bp|location=Sequence derived from alignment at AB537563:314..1510+ (Prunus persica)
back to top