CBF1, JQ317157.1-CBF1 (gene) Prunus dulcis

Gene Overview
NameCBF1
Unique NameJQ317157.1-CBF1
Typegene
OrganismPrunus dulcis (Almond)
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CBF1CBF1Prunus dulcisgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
CBF1JQ317157.1-CBF1.m1Prunus dulcismRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreJQ317157.1
Alignments
Feature NameTypeLocationAnalysis
JQ317157 region JQ317157:1..2436+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>JQ317157.1-CBF1 ID=JQ317157.1-CBF1|Name=CBF1|organism=Prunus dulcis|type=gene|length=2436bp
gattacgtcatcccaactgttcatgcaaacaattgaactggactggacta
aggtaaagtttgtgggtcacataaaaataaacttgattaaataaaaggtc
aatgaaatgaaacaatatgaaagacacgtgtcttgttctaattgatattg
gatcaaagtaacgtaaatctattatgttatgtttcacagtctcaaggtat
agcagatcaatcaaccatgacacaaaatctaaattaaactttaattaatg
taatggaacatctgcttgtgaaaactcaacatttttactggaaaatgaat
ataatcaagggaacttattttcccgtttctattttgcctacttacacttc
tttcgttggaaattgtatgtttttatattttttttatatattttttttta
tagagattcactattatacccaatataagggcccaatttatatttaaaaa
aatcttatataaaatgaattttagaaacacaccaaaaacctatttataac
ataataaaaaggcttttaacttcttataaattacaaaactgctattaatt
tcttaaaaaaaacctaatcccaaaacctcataaaaatacccaaaactcaa
tagggcatcaaagtaatttaataatcaaaattaaattcaatagaccagct
gtcattttttgggttttttgtttgtttatttacagaaattaaatgatgta
cggttatttatattattaatattaaaaatgggtatatgactaaatatcct
ctatttttttgggtcaacctacactcttttttatatataattataatagt
ttgtgcacgtgttataagtagacaacaatattaatatttctcattttaaa
aaataatattaataaatattcaattatattataatacgtagataaattat
aacacatgaccgtattactgtattaaattatagcaccggtaaggttgtaa
ttagtgcgaaagaaagataaaataaaaaaacattgcagtagcccgcatga
gctgaggtgaggtgtgagtggagccacgtaacgcacacttcaaacacaga
caacgtgtcaatttttagtaataaaaccacgtgtgattaaaaaaaagcac
ccgcttattagtttcgtaaacttaatgtgcttccgacccaaaaactaacc
taagtgtgttttactgccacgtggcagagccaagtcaaagcaatgttttc
tgcctccagctcccgatgaatcccccttggtcaatttacttgccactcta
gtagtaaagccgcatttcgagctggccccacatgtctccttccttaggct
ccttccgcagactccgtgtttacgtgtccacacttcggccgcagctgcca
cgcaatccccaatctataaaagtccctctccctcacttccaatttcggct
caagaaactcaaccaagctaaaacaccaaaccattcatacatatcttacg
ctaatgaacaggttcttctctcatttttctgactccgtcgaccagcccga
gtcaagttcgttgtccgacaacacagtcacgactctaagggcttcttggt
ccgacgaggacgtcattttggcgtcgagccgaccaaagaagcgagctggg
aggagggttttcaaggagaccaggcaccctgtttataggggcgtgaggag
gaggaacaatgacaagtgggtgtgtgaaatgagagagcccaagaagacga
agtccaggatatggctcgggacttatccgacggcggagatggctgctcgt
gcccatgacgtggcggcattggcgtttagagggaagcttgcctgcctcaa
cttccctgactccgcttggaggctgcccttgccggcttccatggatgcaa
tggatattcggagagcggccgccgaggcagctgaggggtttaggccggtg
gagtttggtggagtgtccagcagcagcagtgatgagaaggagagaatggt
ggtgcaggtggaagagaagaagaagaagaagaagaaggatagtgtgaata
tggaaaaaagtacaagcttgagcttgtcctattgggatgaggaagaagtg
tttgacatgccaaggttgcttgatgacatggctcaaggccttcttctttc
tccacctcaatgcttaggtggcgacatttgggatgacatgggaaccgatg
ctgatgtcaaattgtggagtttctccaattaataatcaacgtttatttgg
aaatattgaatataaaaggtatatatgagaaagatatttttagtggagat
agatatttaggattgtgtacagtagaaaagtttactaactgtggattcat
tgaattgctttctctttactgggttccttggctgctcactttgttttgtt
ggcttcctttgtgtccctgttggttttgaccgttgtaatttgattttcat
tctttttatatgaattgaaagcttttatgtgtttgg
back to top

gene from alignment at JQ317157:1..2436+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>JQ317157.1-CBF1 ID=JQ317157.1-CBF1|Name=CBF1|organism=Prunus dulcis|type=gene|length=2436bp|location=Sequence derived from alignment at JQ317157:1..2436+ (Prunus dulcis)
gattacgtcatcccaactgttcatgcaaacaattgaactggactggacta aggtaaagtttgtgggtcacataaaaataaacttgattaaataaaaggtc aatgaaatgaaacaatatgaaagacacgtgtcttgttctaattgatattg gatcaaagtaacgtaaatctattatgttatgtttcacagtctcaaggtat agcagatcaatcaaccatgacacaaaatctaaattaaactttaattaatg taatggaacatctgcttgtgaaaactcaacatttttactggaaaatgaat ataatcaagggaacttattttcccgtttctattttgcctacttacacttc tttcgttggaaattgtatgtttttatattttttttatatattttttttta tagagattcactattatacccaatataagggcccaatttatatttaaaaa aatcttatataaaatgaattttagaaacacaccaaaaacctatttataac ataataaaaaggcttttaacttcttataaattacaaaactgctattaatt tcttaaaaaaaacctaatcccaaaacctcataaaaatacccaaaactcaa tagggcatcaaagtaatttaataatcaaaattaaattcaatagaccagct gtcattttttgggttttttgtttgtttatttacagaaattaaatgatgta cggttatttatattattaatattaaaaatgggtatatgactaaatatcct ctatttttttgggtcaacctacactcttttttatatataattataatagt ttgtgcacgtgttataagtagacaacaatattaatatttctcattttaaa aaataatattaataaatattcaattatattataatacgtagataaattat aacacatgaccgtattactgtattaaattatagcaccggtaaggttgtaa ttagtgcgaaagaaagataaaataaaaaaacattgcagtagcccgcatga gctgaggtgaggtgtgagtggagccacgtaacgcacacttcaaacacaga caacgtgtcaatttttagtaataaaaccacgtgtgattaaaaaaaagcac ccgcttattagtttcgtaaacttaatgtgcttccgacccaaaaactaacc taagtgtgttttactgccacgtggcagagccaagtcaaagcaatgttttc tgcctccagctcccgatgaatcccccttggtcaatttacttgccactcta gtagtaaagccgcatttcgagctggccccacatgtctccttccttaggct ccttccgcagactccgtgtttacgtgtccacacttcggccgcagctgcca cgcaatccccaatctataaaagtccctctccctcacttccaatttcggct caagaaactcaaccaagctaaaacaccaaaccattcatacatatcttacg ctaatgaacaggttcttctctcatttttctgactccgtcgaccagcccga gtcaagttcgttgtccgacaacacagtcacgactctaagggcttcttggt ccgacgaggacgtcattttggcgtcgagccgaccaaagaagcgagctggg aggagggttttcaaggagaccaggcaccctgtttataggggcgtgaggag gaggaacaatgacaagtgggtgtgtgaaatgagagagcccaagaagacga agtccaggatatggctcgggacttatccgacggcggagatggctgctcgt gcccatgacgtggcggcattggcgtttagagggaagcttgcctgcctcaa cttccctgactccgcttggaggctgcccttgccggcttccatggatgcaa tggatattcggagagcggccgccgaggcagctgaggggtttaggccggtg gagtttggtggagtgtccagcagcagcagtgatgagaaggagagaatggt ggtgcaggtggaagagaagaagaagaagaagaagaaggatagtgtgaata tggaaaaaagtacaagcttgagcttgtcctattgggatgaggaagaagtg tttgacatgccaaggttgcttgatgacatggctcaaggccttcttctttc tccacctcaatgcttaggtggcgacatttgggatgacatgggaaccgatg ctgatgtcaaattgtggagtttctccaattaataatcaacgtttatttgg aaatattgaatataaaaggtatatatgagaaagatatttttagtggagat agatatttaggattgtgtacagtagaaaagtttactaactgtggattcat tgaattgctttctctttactgggttccttggctgctcactttgttttgtt ggcttcctttgtgtccctgttggttttgaccgttgtaatttgattttcat tctttttatatgaattgaaagcttttatgtgtttgg
back to top