LFY, EU500478.1-LFY.m1 (mRNA) Crataegus wilsonii

Transcript Overview
Unique NameEU500478.1-LFY.m1
OrganismCrataegus wilsonii ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYEU500478.1-LFYCrataegus wilsoniigene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus wilsoniigene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU500478.1-LFY.m1-cds1EU500478.1-LFY.m1-cds1Crataegus wilsoniiCDS
EU500478.1-LFY.m1-cds2EU500478.1-LFY.m1-cds2Crataegus wilsoniiCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYEU500478.1-LFY.p1Crataegus wilsoniipolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EU500478 region EU500478:1..1038+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductLEAFY protein
The following sequences are available for this feature:

mRNA sequence

>EU500478.1-LFY.m1 ID=EU500478.1-LFY.m1|Name=LFY|organism=Crataegus wilsonii|type=mRNA|length=588bp
back to top

protein sequence of LFY

>EU500478.1-LFY.p1 ID=EU500478.1-LFY.p1|Name=LFY|organism=Crataegus wilsonii|type=polypeptide|length=196bp
back to top

mRNA from alignment at EU500478:1..1038+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU500478.1-LFY.m1 ID=EU500478.1-LFY.m1|Name=LFY|organism=Crataegus wilsonii|type=mRNA|length=1038bp|location=Sequence derived from alignment at EU500478:1..1038+ (Crataegus wilsonii)
gaagcatccgtaacgccagtagcggcagctgctgcggcggcggctggtta tactttgcggccgccaagggagcttggaattggagggcttgaagacttgt tccaggcttatggggttagatactacacgacggcgaagatagcggagctt ggatttactgcgaacaccctcttggacatgaaggatgatgagcttgatga catgatgagcagcctctctcagatattccgctgggagttgcttgttgggg agaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgag gaggatgactctcggcggcgcaaccttgtctctggtgataccaccaccaa tgccctagatgctctctcccaagaaggtactatgaatattatttaccctt gtgtcttagattaaccgtagtatataggcatacaggtagggtttgatcac actttgaaataacattattttacatgtaaattaatagtgcgacaaaataa catgttcaaacagatgataaaaaaaattagaatttagtgaatcaaagaag aaaaataggtcgcaaaacattaaaacttttggcctttggtgtaataattt gatggaaataacaaatcaaagatgtttattattttgtgacatactatgcc agatcataagatgttcgagattgcgcgataaaactaaaagcatatgtttt atatgattgtaacataatatgtcaattatcgtagtctttgatactagaac ataaagtagttgttatattagattgggatgtatgacacgctgtgcatggg atgtgtagggctgtccgaggagccagtgcaacaagagaaggagatggtgg ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcgg aagaaacagcggaggatgaagaaggggcaatataggaactgtagtgctgg agggggtcataataatgatcataacgagggtgtagacgacaaggacgacg acatggacgaaatgaatgggcaggggaacggtggagga
back to top

Coding sequence (CDS) from alignment at EU500478:1..1038+

>EU500478.1-LFY.m1 ID=EU500478.1-LFY.m1|Name=LFY|organism=Crataegus wilsonii|type=CDS|length=588bp|location=Sequence derived from alignment at EU500478:1..1038+ (Crataegus wilsonii)
back to top