COX1, EU701212.1-COX1 (gene) Rubus odoratus

Gene Overview
NameCOX1
Unique NameEU701212.1-COX1
Typegene
OrganismRubus odoratus ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
COX1COX1Rubus odoratusgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
COX1EU701212.1-COX1.m1Rubus odoratusmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEU701212.1
Alignments
Feature NameTypeLocationAnalysis
EU701212 region EU701212:1..655+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU701212.1-COX1 ID=EU701212.1-COX1|Name=COX1|organism=Rubus odoratus|type=gene|length=655bp
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgg
gcacatgcttctcagtactgattcgtatggaattagcacgacccggcgat
caaattcttggtgggaatcatcaactttataatgttttaataacggctca
cgcttttttaatgatcttttttatggttatgccggcgatgataggtggat
ttggtaattggtttgttccgattctgataggtgcacctgacatggcattt
ccacgattaaataatatttcattctggttgttgccaccaagtctcttgct
cctattaagctcagccttagtagaagtgggtagcgggactgggtggacgg
tctatccgcccttaagtggtattaccagccattctggaggagctgttgat
ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttc
tatcaattttataacaactatctccaacatgcgtggacctggaatgacta
tgcatagattacccctatttgtgtggtccgttctagtgacagcattccta
cttttattatcacttccggtactggcaggggcaattaccatgttattaac
cgatcgaaactttaatacaaccttttttgatcccgctggggggggagacc
ccata
back to top

gene from alignment at EU701212:1..655+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU701212.1-COX1 ID=EU701212.1-COX1|Name=COX1|organism=Rubus odoratus|type=gene|length=655bp|location=Sequence derived from alignment at EU701212:1..655+ (Rubus odoratus)
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgg gcacatgcttctcagtactgattcgtatggaattagcacgacccggcgat caaattcttggtgggaatcatcaactttataatgttttaataacggctca cgcttttttaatgatcttttttatggttatgccggcgatgataggtggat ttggtaattggtttgttccgattctgataggtgcacctgacatggcattt ccacgattaaataatatttcattctggttgttgccaccaagtctcttgct cctattaagctcagccttagtagaagtgggtagcgggactgggtggacgg tctatccgcccttaagtggtattaccagccattctggaggagctgttgat ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttc tatcaattttataacaactatctccaacatgcgtggacctggaatgacta tgcatagattacccctatttgtgtggtccgttctagtgacagcattccta cttttattatcacttccggtactggcaggggcaattaccatgttattaac cgatcgaaactttaatacaaccttttttgatcccgctggggggggagacc ccata
back to top