COX1, EU701201.1-COX1 (gene) Rubus allegheniensis

Gene Overview
Unique NameEU701201.1-COX1
OrganismRubus allegheniensis ()
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
COX1COX1Rubus allegheniensisgene

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
COX1EU701201.1-COX1.m1Rubus allegheniensismRNA

Cross References
External references for this gene
Feature NameTypeLocationAnalysis
EU701201 region EU701201:1..655+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

gene sequence

>EU701201.1-COX1 ID=EU701201.1-COX1|Name=COX1|organism=Rubus allegheniensis|type=gene|length=655bp
back to top

gene from alignment at EU701201:1..655+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU701201.1-COX1 ID=EU701201.1-COX1|Name=COX1|organism=Rubus allegheniensis|type=gene|length=655bp|location=Sequence derived from alignment at EU701201:1..655+ (Rubus allegheniensis)
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgg gcacatgcttctcagtactgattcgtatggaattagcacgacccggcgat caaattcttggtgggaatcatcaactttataatgttttaataacggctca cgcttttttaatgatcttttttatggttatgccggcgatgataggtggat ttggtaattggtttgttcctattctgataggtgcacctgacatggcattt ccacgattaaataatatttcattctggttgttgccaccaagtctcttgct cctattaagctcagccttagtagaagtgggtagcgggactgggtggacgg tctatccgcccttaagtggtattaccagccattctggaggagctgttgat ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttc tatcaattttataacaactatctccaacatgcgtggacctggaatgacta tgcatagatcacccctatttgtgtggtccgttccagtgacagcattccta cttttattatcacttccggtactggcaggggcaattaccatgttattaac cgatcgaaactttaatacaaccttttctgatcccgctggggggggagacc ccata
back to top