CDPK, EF519915.1-CDPK.m1 (mRNA) Malus hupehensis

Transcript Overview
Unique NameEF519915.1-CDPK.m1
OrganismMalus hupehensis ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CDPKCDPKMalus hupehensisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EF519915.1-CDPK.m1-cds1EF519915.1-CDPK.m1-cds1Malus hupehensisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
CDPKEF519915.1-CDPK.p1Malus hupehensispolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EF519915 region EF519915:1..1701+ NCBI Rosaceae gene and mRNA sequences
Chr02 chromosome Chr02:30964904..30970801+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr2 chromosome chr2:29570514..29576411+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
Property NameValue
Productcalcium-dependent calmodulin-independent protein kinase
The following sequences are available for this feature:

mRNA sequence

>EF519915.1-CDPK.m1 ID=EF519915.1-CDPK.m1|Name=CDPK|organism=Malus hupehensis|type=mRNA|length=1701bp
back to top

protein sequence of CDPK

>EF519915.1-CDPK.p1 ID=EF519915.1-CDPK.p1|Name=CDPK|organism=Malus hupehensis|type=polypeptide|length=566bp
back to top

mRNA from alignment at EF519915:1..1701+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EF519915.1-CDPK.m1 ID=EF519915.1-CDPK.m1|Name=CDPK|organism=Malus hupehensis|type=mRNA|length=1701bp|location=Sequence derived from alignment at EF519915:1..1701+ (Malus hupehensis)
atgggtaatacttgtgttggacctagcatttccaagaatggtttcttcca atcagtttcagctgtaatgtggccaaaccggtcgcctgatgactcagttc acacaaacggagaagctgtcgctgagacatcatcacctaaggaacctgag tcacctatgccagtactagacaaaccaccagagcaagtgacaataccaaa tccagaaaccgagccaaaacaatccgcaaaacccaagaagctaccacaga tgaagagggtccctagtgcaggactcgctggttcggtgttgcaaacgaaa actggaaagttaaaggagttttacagtttggggagaaaactaggacaagg gcagtttggaattacgtttctgtgtgtggagaaggcgacagggaaagagt atgcgtgcaaatcgattgcaaaaaggaagttaataactgatgaggatgtg gaggatgtgaggagggaaattcagatcatgcaccatttggcagggcaccc aaatgttatatctattaagggagcttatgaggatgctatagcagttcatg ttgtaatggaattatgtgcaggaggtgagctgtttgataggattatccag cgtgggcattatacagaaagaaaggcagctgagctaactaggactatagt tggagttgtcgaagcttgccattcattgggagttatgcatcgagacctta agccggagaattttctttttgtcagtcaggatgaggatgcactactgaaa actattgattttggattatctattttcttgaagccaggagtaaaatttac tgatgtggttggaagtccatattatgttgcacctgaagtgttacgcaagc gttatggtccagaagcagatgtctggagtgcaggagtaatcctttacatt ctgttaagtggggtacctccattttgggctgaaggtgagcacggaatatt tgaacaggtcctgcatggtgacttagattttgaatcagacccttggccta gtatttctgatggtgccaaagatttagtgaggagaatgcttgtccgagac cctaaaaggcggctgacagcacatgaagttttgtgccacccctgggtgca agttgatggtgtggctcccgataaggctcttgattctgcagttctaagtc gcttaaaacaattttcagctatgaacaagctcaagaaaatggctctcaga gtaattgcagagaggttgtctgaagaagaaatagctggcctgaaagaaat gttcaagatgatagacactgacaacagtggtcaaatcacttttgacgaac tcaaggccggattgaaaagatttggagcaactctggaggagtctgaaatt tatgatctaatgcaagcagcagatgtcgataacagtggaaccattgatta tggggagttcgtagctgcaacattgcatctgaacaaaattgagagagaag atcatctattttcagctttctcctactttgataaggatggaagtggctat attacttcagatgagcttcaagtagcttgtgaggagtttggcatagagga tgttcggctcgaagagatgataagagaagttgatcaggacaatgatggac gcatagattacaacgagtttgtagccatgatgcagaaaggaaattttgtt ggcccgggtaagaagggattgcaaagtagcttcagcattgcctttagata a
back to top

Coding sequence (CDS) from alignment at EF519915:1..1701+

>EF519915.1-CDPK.m1 ID=EF519915.1-CDPK.m1|Name=CDPK|organism=Malus hupehensis|type=CDS|length=1701bp|location=Sequence derived from alignment at EF519915:1..1701+ (Malus hupehensis)
back to top