ANR, GU938697.1-ANR (gene) Prunus avium

Gene Overview
NameANR
Unique NameGU938697.1-ANR
Typegene
OrganismPrunus avium ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ANRANRPrunus aviumgene


Cross References
External references for this gene
DatabaseAccession
nuccoreGU938697.1
Alignments
Feature NameTypeLocationAnalysis
GU938697 region GU938697:1..1747+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Genbank noteanthocyanidin reductase
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>GU938697.1-ANR ID=GU938697.1-ANR|Name=ANR|organism=Prunus avium|type=gene|length=1747bp
attactgaatagggcactatagagtctatatagaaactatttggattcaa
acactactacataaacttttcaaattgtaaaaggaagaactgttttggtc
ctatatctatgattaccctctgcccacaagttgtgtttgatgatattatt
tggcttgtatgaagattgctgctgtcatgttttcagagtgatgattgttc
attcttccattcatctttctgatattgttttttgactgtgatgttaacat
tttctctgaacatatgatcagaaaggagaggtagtagaatcatctctatg
gttgttggttatgacttatagcatgaccgttgtctctgtttgcacagaat
ttgttgaagatgttgatctgctgattagaagggccgagagatgcttagaa
gcaggggctgacatgataatgattgatgctgatgatgtctgtaaacaagc
tgattcaatgcgggcagacataattgcgaagatcattgggcgtcttggtg
ttgagaagaccatgtttgaagcatcaaatccaagaacatcagagtggttt
gtcatacagtatggtccaagggtataatgctctttcataaacttttacat
aatttcttttattgggaaaatgtgttgcatgtcattatatccttcttgtt
tgcctgaattttcaggtgaatctgtttgtggatcactcacaagtgatgga
tctggagtgcctccggggacgaagcttaggtaaaaaccatacatctgtgc
tgggttcctcgtattttctgttctgaactttttgtaataagaagggggag
aaagttatggtaatatgcgtatgtgtctcttgttggatctggtcgtgttg
tcttatgaatttgtgctgttgatgtaactttgttcaatataacctttgtt
ccagtgtgtaaaacattaccttttaagattttgagaatcattgttgcaac
tgatctccactcttgaaactcatgacttttgtctcctcacaccaagttga
aattcaatgatgtatttgtattacaatccagtacttatgatatttccacc
aacaattgtattcttttatttttgtaaatgcatggtgcatgaagttcagt
ggccaaagctgcaaggaagaagttcatatacgcacgatgttgtatatagg
caacaaatataaagcattatattatagtatcgatcttgagaaaaaatttt
aaaaataaaataatgacggattgacaagtgaggtcggtttcagacccaaa
aaaaaatataaaaaaaagaagtgatatccgtaattcttctcgtagctacg
acgtcgcgcgtgcgggtgcccaatgcccagctaacacctgaatatctaac
tcaatctaaacaagtggcccaacagctcataatctcggaatgaaaatagt
cttatgttgtttcttttcttttaacgtagttaattgaattttttatttaa
aggtgaagctttatgtggtaaggaaaaaactcctttgacttggacaaaca
aagaaatatatgttgtttgtttcagagactctgcaccaaacactaagaaa
gaaaaagaaaatgtgttttgagttggtggtgcatagatcatcacgtgctc
accttcttcctccagactcaattagatggagatgagcagcttctagtcta
tttaagaagtaaacatccgttgacagaaataccagtctcataattccttc
tagtcctaaccaccagtgaactctgaaacttagcaactgaaagagcc
back to top