GAPDH, DQ091174.1-GAPDH (gene) Rosa setigera

Gene Overview
NameGAPDH
Unique NameDQ091174.1-GAPDH
Typegene
OrganismRosa setigera ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa setigeragene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091174.1-GAPDH.m1Rosa setigeramRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreDQ091174.1
Alignments
Feature NameTypeLocationAnalysis
DQ091174 region DQ091174:1..761+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>DQ091174.1-GAPDH ID=DQ091174.1-GAPDH|Name=GAPDH|organism=Rosa setigera|type=gene|length=761bp
gtcttatgactaccgtgcactccatcactggtgatttttcacttgtaacc
atgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtc
gtctgtgtatttgcaattcagccacccagaagactgttgatggaccatca
gcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccag
cagcactggagctgccaaggtattttcaatattctttgtgccactgcttc
agtattgttgatacacttttaagttgcatgtcagtggtacttcatctgta
acagctttattaatccttgattttggaatatctttaggctgtcggaaagg
ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggc
aacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttg
atgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatt
cttggttctaatcttttatctttaattctgtctgaacagggaggagtctg
agggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtca
actgacttcattggtgacaacaggtaaatgaatattagtcatttaatggt
tggagtactacgtaaccatctatgctgtttggattagtgatcatcatgtg
gtgaatttatt
back to top

gene from alignment at DQ091174:1..761+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ091174.1-GAPDH ID=DQ091174.1-GAPDH|Name=GAPDH|organism=Rosa setigera|type=gene|length=761bp|location=Sequence derived from alignment at DQ091174:1..761+ (Rosa setigera)
gtcttatgactaccgtgcactccatcactggtgatttttcacttgtaacc atgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtc gtctgtgtatttgcaattcagccacccagaagactgttgatggaccatca gcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccag cagcactggagctgccaaggtattttcaatattctttgtgccactgcttc agtattgttgatacacttttaagttgcatgtcagtggtacttcatctgta acagctttattaatccttgattttggaatatctttaggctgtcggaaagg ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggc aacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttg atgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatt cttggttctaatcttttatctttaattctgtctgaacagggaggagtctg agggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtca actgacttcattggtgacaacaggtaaatgaatattagtcatttaatggt tggagtactacgtaaccatctatgctgtttggattagtgatcatcatgtg gtgaatttatt
back to top