GAPDH, DQ091128.1-GAPDH (gene) Rosa carolina

Gene Overview
NameGAPDH
Unique NameDQ091128.1-GAPDH
Typegene
OrganismRosa carolina ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa carolinagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091128.1-GAPDH.m1Rosa carolinamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreDQ091128.1
Alignments
Feature NameTypeLocationAnalysis
DQ091128 region DQ091128:1..751+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>DQ091128.1-GAPDH ID=DQ091128.1-GAPDH|Name=GAPDH|organism=Rosa carolina|type=gene|length=751bp
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatact
agatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccaccca
gaagactgttgatggcccatcagcaaaggactggagaggtggacgtgctg
cctcattcaacatcattcccagcagcactggagctgccaaggtattttca
atattctttgtgccactgcttcagtattgttgatacacttgtaagttacg
tgtctgtgatacttcatctttaacagctttattaatccttgattttggaa
tatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgac
cggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatc
aagtaaggcttgttgaactttgttgttaattagttgcaatcaaggtgggg
tgtcatgacattacaatgcatgtcttggttctaatcttttatctttaatt
ctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggtt
acaccgatgaggatgttgtgtcaactgacttcattggtgacaacaggtaa
atgaatattagtcatttaatggttggagtactacgtacagaataaaccat
ctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttat
t
back to top

gene from alignment at DQ091128:1..751+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ091128.1-GAPDH ID=DQ091128.1-GAPDH|Name=GAPDH|organism=Rosa carolina|type=gene|length=751bp|location=Sequence derived from alignment at DQ091128:1..751+ (Rosa carolina)
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatact agatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccaccca gaagactgttgatggcccatcagcaaaggactggagaggtggacgtgctg cctcattcaacatcattcccagcagcactggagctgccaaggtattttca atattctttgtgccactgcttcagtattgttgatacacttgtaagttacg tgtctgtgatacttcatctttaacagctttattaatccttgattttggaa tatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgac cggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatc aagtaaggcttgttgaactttgttgttaattagttgcaatcaaggtgggg tgtcatgacattacaatgcatgtcttggttctaatcttttatctttaatt ctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggtt acaccgatgaggatgttgtgtcaactgacttcattggtgacaacaggtaa atgaatattagtcatttaatggttggagtactacgtacagaataaaccat ctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttat t
back to top