GAPDH, DQ091118.1-GAPDH (gene) Rosa carolina

Gene Overview
Unique NameDQ091118.1-GAPDH
OrganismRosa carolina ()
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa carolinagene

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091118.1-GAPDH.m1Rosa carolinamRNA

Cross References
External references for this gene
Feature NameTypeLocationAnalysis
DQ091118 region DQ091118:1..751+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

gene sequence

>DQ091118.1-GAPDH ID=DQ091118.1-GAPDH|Name=GAPDH|organism=Rosa carolina|type=gene|length=751bp
back to top

gene from alignment at DQ091118:1..751+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ091118.1-GAPDH ID=DQ091118.1-GAPDH|Name=GAPDH|organism=Rosa carolina|type=gene|length=751bp|location=Sequence derived from alignment at DQ091118:1..751+ (Rosa carolina)
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatact agatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccaccca gaagactgttgacggaccatcagcaaaggactggagaggtggacgtgctg cctcattcaacatcattcccagcagcactggagctgccaaggtattttca atattctttgtgccactgcttcagtattgttgatacacttgtaagttgca tgtcagtgattcttcatctttaacagctttattaatccttgattttggaa tatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgac cggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatc aagtaaggcttgttgaactttgttgttaattagttgcaatcaaggtgtgg tgtcatgacattacaatgcatgtcttggttctaatcttttatctttaatt ctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggtt acaccgatgaggatgttgtgtcaactgacttcattggtgacaacaggtaa atgaatattagtcatttaatggttggcgtactacgtacagaataaaccat ctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttat t
back to top