GAPDH, DQ091059.1-GAPDH (gene) Rosa palustris

Gene Overview
NameGAPDH
Unique NameDQ091059.1-GAPDH
Typegene
OrganismRosa palustris ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa palustrisgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091059.1-GAPDH.m1Rosa palustrismRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreDQ091059.1
Alignments
Feature NameTypeLocationAnalysis
DQ091059 region DQ091059:1..754+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>DQ091059.1-GAPDH ID=DQ091059.1-GAPDH|Name=GAPDH|organism=Rosa palustris|type=gene|length=754bp
cactggtgagttttcacttgcaaccatgtgagatatatgaatgttaagat
actagatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccac
ccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtg
ctgcctcattcaacatcattcccagcagcactggagctgccaaggtattt
tcaatattctttgtgccactgcttcagtattgttgatacacttgtaagtt
acatgtcagtgatacttcatctttaacagctttattaatccttgattttg
gaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagtt
gaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgct
atcaagtaaggcttgttgaactttgttgttaattagttgcaatcaaggtg
gggtgtcatgacattacaatgcatgtcttggttctaatcttttatcttta
attctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgg
gttacaccgatgaggatgttgtgtcaactgacttcattggtgacaacagg
taaatgaatattagtcatttaatggttggagtactacgtacagaataaac
catctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatt
tatt
back to top

gene from alignment at DQ091059:1..754+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ091059.1-GAPDH ID=DQ091059.1-GAPDH|Name=GAPDH|organism=Rosa palustris|type=gene|length=754bp|location=Sequence derived from alignment at DQ091059:1..754+ (Rosa palustris)
cactggtgagttttcacttgcaaccatgtgagatatatgaatgttaagat actagatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccac ccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtg ctgcctcattcaacatcattcccagcagcactggagctgccaaggtattt tcaatattctttgtgccactgcttcagtattgttgatacacttgtaagtt acatgtcagtgatacttcatctttaacagctttattaatccttgattttg gaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagtt gaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc tcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgct atcaagtaaggcttgttgaactttgttgttaattagttgcaatcaaggtg gggtgtcatgacattacaatgcatgtcttggttctaatcttttatcttta attctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgg gttacaccgatgaggatgttgtgtcaactgacttcattggtgacaacagg taaatgaatattagtcatttaatggttggagtactacgtacagaataaac catctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatt tatt
back to top