GAPDH, DQ091044.1-GAPDH (gene) Rosa gymnocarpa

Gene Overview
NameGAPDH
Unique NameDQ091044.1-GAPDH
Typegene
OrganismRosa gymnocarpa ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa gymnocarpagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091044.1-GAPDH.m1Rosa gymnocarpamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreDQ091044.1
Alignments
Feature NameTypeLocationAnalysis
DQ091044 region DQ091044:1..779+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>DQ091044.1-GAPDH ID=DQ091044.1-GAPDH|Name=GAPDH|organism=Rosa gymnocarpa|type=gene|length=779bp
gtcttatgactaccgtgcactccatcactggtgagttctcacttgtaacc
atgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtc
gtctgtgtatttgcaattcagccacccagaagactgttgatggaccatca
gcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccag
cagcactggagctgccaaggtattttcaatgttctttgtgccactgcttc
agtattgttgatacacttttaagttacatgtcagtgatacttcatctgta
acagctttattaatccttgattttggaatatctttaggctgtcggaaagg
ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggc
aacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttg
ttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatg
tcttggttctaatcttttatctttaattctgtctgaacagggaggagtct
gagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtc
aaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatgg
ttggagtactatgtacagaataaaccatctatgctgtttggattagtgat
catcttgaagttgcagtggtgaatttatc
back to top

gene from alignment at DQ091044:1..779+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ091044.1-GAPDH ID=DQ091044.1-GAPDH|Name=GAPDH|organism=Rosa gymnocarpa|type=gene|length=779bp|location=Sequence derived from alignment at DQ091044:1..779+ (Rosa gymnocarpa)
gtcttatgactaccgtgcactccatcactggtgagttctcacttgtaacc atgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtc gtctgtgtatttgcaattcagccacccagaagactgttgatggaccatca gcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccag cagcactggagctgccaaggtattttcaatgttctttgtgccactgcttc agtattgttgatacacttttaagttacatgtcagtgatacttcatctgta acagctttattaatccttgattttggaatatctttaggctgtcggaaagg ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggc aacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttg ttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatg tcttggttctaatcttttatctttaattctgtctgaacagggaggagtct gagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtc aaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatgg ttggagtactatgtacagaataaaccatctatgctgtttggattagtgat catcttgaagttgcagtggtgaatttatc
back to top