LFY, AY555358.1-LFY (gene) Physocarpus malvaceus

Gene Overview
NameLFY
Unique NameAY555358.1-LFY
Typegene
OrganismPhysocarpus malvaceus ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYPhysocarpus malvaceusgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYAY555358.1-LFY.m1Physocarpus malvaceusmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAY555358.1
Alignments
Feature NameTypeLocationAnalysis
AY555358 region AY555358:1..901+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AY555358.1-LFY ID=AY555358.1-LFY|Name=LFY|organism=Physocarpus malvaceus|type=gene|length=901bp
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgat
attgttagaaacgataatttctactgtggtaaatacttgtaatttacaac
ctgatctttgtgggcccattgtaggctagtggcccacaattgaagaggcc
tgctgacaccttcaatataaatgtttgagctaactgtaggagcccaaatt
cacaagaaatcaaaatctttaataggtttgttactaatttaggaattttg
ccacttagcactacggttgagtattatttctcttcacttgtaagtcagag
gtcttaggttcaagtctcggcaagcccattgtgtagcttagtctaattat
cacccctttagtgtaaatattgttgtatttaaaaaaaaaaactaatttag
gaactttggattcctttgggattacttctagagaatacacttttacctat
aaatacttcttttactaaaagcacaacaaaagcactcgggagtgcttctc
caagaaccataaaaatgcgttcattattttaaccaaacactatcagcact
tgtggatttttgaaagcgcttttagccctgtaaaataggctctaaatatt
ccaacatttatctaaatttggtttgactggccagatgttagacagtgatt
gatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaag
tctagacccaattgttagtgcattcgactactattttatcctataggtga
atgttttctttttgttctatagtttgaagtgtttttaactaacattaaca
actgtcataagtactaacggtgcataattattagacggattaggtatctt
acttattatatatgcaggtgacaaaccaggtgtttaggtatgccaaaaag
g
back to top

gene from alignment at AY555358:1..901+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AY555358.1-LFY ID=AY555358.1-LFY|Name=LFY|organism=Physocarpus malvaceus|type=gene|length=901bp|location=Sequence derived from alignment at AY555358:1..901+ (Physocarpus malvaceus)
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgat attgttagaaacgataatttctactgtggtaaatacttgtaatttacaac ctgatctttgtgggcccattgtaggctagtggcccacaattgaagaggcc tgctgacaccttcaatataaatgtttgagctaactgtaggagcccaaatt cacaagaaatcaaaatctttaataggtttgttactaatttaggaattttg ccacttagcactacggttgagtattatttctcttcacttgtaagtcagag gtcttaggttcaagtctcggcaagcccattgtgtagcttagtctaattat cacccctttagtgtaaatattgttgtatttaaaaaaaaaaactaatttag gaactttggattcctttgggattacttctagagaatacacttttacctat aaatacttcttttactaaaagcacaacaaaagcactcgggagtgcttctc caagaaccataaaaatgcgttcattattttaaccaaacactatcagcact tgtggatttttgaaagcgcttttagccctgtaaaataggctctaaatatt ccaacatttatctaaatttggtttgactggccagatgttagacagtgatt gatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaag tctagacccaattgttagtgcattcgactactattttatcctataggtga atgttttctttttgttctatagtttgaagtgtttttaactaacattaaca actgtcataagtactaacggtgcataattattagacggattaggtatctt acttattatatatgcaggtgacaaaccaggtgtttaggtatgccaaaaag g
back to top