LFY, AY555356.1-LFY (gene) Physocarpus malvaceus

Gene Overview
NameLFY
Unique NameAY555356.1-LFY
Typegene
OrganismPhysocarpus malvaceus ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYPhysocarpus malvaceusgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYAY555356.1-LFY.m1Physocarpus malvaceusmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAY555356.1
Alignments
Feature NameTypeLocationAnalysis
AY555356 region AY555356:1..902+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AY555356.1-LFY ID=AY555356.1-LFY|Name=LFY|organism=Physocarpus malvaceus|type=gene|length=902bp
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgat
attgttagaaacgataatttctactgtggtaaatacttgtaatttacaac
ctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcc
tgctgacaccttcaatataaatgttttagctaactgtaggagcccaaatt
cacaagaaatcaaaatctttaataggtttgttactaatttaggaattttg
ccacttagcactacggttgagtagtatttctcttcacttgtaagtcagag
gtcttaggttcaagtctcggcaagttcattgtgtgacttagtctaattct
cacccctttaatgtaaatatcattgtatttaaaaaaaaaaactaatttag
gaactttggattcctttggaattacttctatagaatacacttttacctat
aaatacttcttttactaaaagcacaacaaaagcactagggagtgcttctc
caagaaccataaaaatgcgttcattattttaaccaaacactatcagcact
tgtggatttttgaaagcgcttttagccctgtaaaataggctctaaatatt
ccaacatttatctgaatttggtttgactggccagatgttagacagtgatt
gatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaag
tctagacccaattgttagtgcattcgactattattttatccgataggtga
atgttttcttttttgttctacagtttgaagtgtttttaactaacattaac
aactgtcataagtactaacggtgcataattattagacggattaagtatct
tacttattatatatgcaggtgacaaaccaggtgtttaggtatgccaaaaa
gg
back to top

gene from alignment at AY555356:1..902+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AY555356.1-LFY ID=AY555356.1-LFY|Name=LFY|organism=Physocarpus malvaceus|type=gene|length=902bp|location=Sequence derived from alignment at AY555356:1..902+ (Physocarpus malvaceus)
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgat attgttagaaacgataatttctactgtggtaaatacttgtaatttacaac ctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcc tgctgacaccttcaatataaatgttttagctaactgtaggagcccaaatt cacaagaaatcaaaatctttaataggtttgttactaatttaggaattttg ccacttagcactacggttgagtagtatttctcttcacttgtaagtcagag gtcttaggttcaagtctcggcaagttcattgtgtgacttagtctaattct cacccctttaatgtaaatatcattgtatttaaaaaaaaaaactaatttag gaactttggattcctttggaattacttctatagaatacacttttacctat aaatacttcttttactaaaagcacaacaaaagcactagggagtgcttctc caagaaccataaaaatgcgttcattattttaaccaaacactatcagcact tgtggatttttgaaagcgcttttagccctgtaaaataggctctaaatatt ccaacatttatctgaatttggtttgactggccagatgttagacagtgatt gatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaag tctagacccaattgttagtgcattcgactattattttatccgataggtga atgttttcttttttgttctacagtttgaagtgtttttaactaacattaac aactgtcataagtactaacggtgcataattattagacggattaagtatct tacttattatatatgcaggtgacaaaccaggtgtttaggtatgccaaaaa gg
back to top