LFY, AY555337.1-LFY (gene) Physocarpus alternans

Gene Overview
NameLFY
Unique NameAY555337.1-LFY
Typegene
OrganismPhysocarpus alternans ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYPhysocarpus alternansgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYAY555337.1-LFY.m1Physocarpus alternansmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAY555337.1
Alignments
Feature NameTypeLocationAnalysis
AY555337 region AY555337:1..901+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AY555337.1-LFY ID=AY555337.1-LFY|Name=LFY|organism=Physocarpus alternans|type=gene|length=901bp
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaat
attgttagaaacgataatttctactgtggtaaatacttgtaatttacaac
ctgatctttgtgggcccattgtaggctagtgggccacaattgaagagcct
gctgacaccttcaatataaatgtttgagctaactgtaggagcccaaattc
acaagaaatcaaaatctttaataggtttgttactaatttaggaattttgc
cacttagcactacggtttagtaggatttttcttcacttgtaagtcagagg
tcttaggttcaagtctcggcaagcccattatgtggcttagtctaattctc
accctttagtgtaaatatcgttgtatttaaaaaaaaactaatttaggaac
tttggattcctttgggattacttctagagaatacacttttacctataaat
acttcttttactaaaagcacaacaaaagcactcgggagtgcttctccaag
aaccataaaaatgcgttcattattttaaccaaacactatcagcagcactt
gtggatttttgaaagcgcttttagccctgtaaaataggctctaaatattc
caacatttatctaaatttggtttgactggccagatgttagacagtgattg
atttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagt
ctagacccaattgttagtgcattcgactattattgtatccgataggtgaa
tgttttcttttttgttctacagtttgaagtgtttttaactaacattaaca
actgtcataagtactaacggtgcataattattagacggattaagtatctt
acttattatatatgcaggtgacaaaccaggtgtttaggtatgccaaaaag
g
back to top

gene from alignment at AY555337:1..901+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AY555337.1-LFY ID=AY555337.1-LFY|Name=LFY|organism=Physocarpus alternans|type=gene|length=901bp|location=Sequence derived from alignment at AY555337:1..901+ (Physocarpus alternans)
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacaat attgttagaaacgataatttctactgtggtaaatacttgtaatttacaac ctgatctttgtgggcccattgtaggctagtgggccacaattgaagagcct gctgacaccttcaatataaatgtttgagctaactgtaggagcccaaattc acaagaaatcaaaatctttaataggtttgttactaatttaggaattttgc cacttagcactacggtttagtaggatttttcttcacttgtaagtcagagg tcttaggttcaagtctcggcaagcccattatgtggcttagtctaattctc accctttagtgtaaatatcgttgtatttaaaaaaaaactaatttaggaac tttggattcctttgggattacttctagagaatacacttttacctataaat acttcttttactaaaagcacaacaaaagcactcgggagtgcttctccaag aaccataaaaatgcgttcattattttaaccaaacactatcagcagcactt gtggatttttgaaagcgcttttagccctgtaaaataggctctaaatattc caacatttatctaaatttggtttgactggccagatgttagacagtgattg atttcaaacatgggtcaagaccaaattgcataattttgtaggaaaaaagt ctagacccaattgttagtgcattcgactattattgtatccgataggtgaa tgttttcttttttgttctacagtttgaagtgtttttaactaacattaaca actgtcataagtactaacggtgcataattattagacggattaagtatctt acttattatatatgcaggtgacaaaccaggtgtttaggtatgccaaaaag g
back to top