S1-RNase, HQ689389.1-S1-RNase (gene) Malus x domestica

Gene Overview
NameS1-RNase
Unique NameHQ689389.1-S1-RNase
Typegene
OrganismMalus x domestica (Apple)
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
S1-RNaseS1-RNaseMalus x domesticagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
S1-RNaseHQ689389.1-S1-RNase.m1Malus x domesticamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreHQ689389.1
Alignments
Feature NameTypeLocationAnalysis
HQ689389 region HQ689389:1..539+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>HQ689389.1-S1-RNase ID=HQ689389.1-S1-RNase|Name=S1-RNase|organism=Malus x domestica|type=gene|length=539bp
tttacgcagcaatatcagccggctgtctgcaactctaatccaactccttg
taaggatcctcctgacaagttgtttaccgttcacggtttgtggccttcaa
actcgaatggaaatgacccagaatattgtaaggcaccgccatatcatacg
gtaatattattagcataatcagatagtcaatattatttctctcatttatg
tacttgtgtgtgtgtatatatatatttttggataatgctaaagtcaccaa
gtttttaaaccaaattatgtgtcacagtataaaataaacacgttaatcaa
cacttaaataataattcaatcatcaacatctacatcatttgattacaaaa
aagtttgtcttcctagcattactctatattttttttatatatacatatac
tcaacacaggttttcatgcaggcgtgtagaaatattacaattaatttaaa
atttaatcataaattatttctattatatattattatattgtcagataaaa
atgctcgaaccccagttggtaatgatttggccgaacgta
back to top

gene from alignment at HQ689389:1..539+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>HQ689389.1-S1-RNase ID=HQ689389.1-S1-RNase|Name=S1-RNase|organism=Malus x domestica|type=gene|length=539bp|location=Sequence derived from alignment at HQ689389:1..539+ (Malus x domestica)
tttacgcagcaatatcagccggctgtctgcaactctaatccaactccttg taaggatcctcctgacaagttgtttaccgttcacggtttgtggccttcaa actcgaatggaaatgacccagaatattgtaaggcaccgccatatcatacg gtaatattattagcataatcagatagtcaatattatttctctcatttatg tacttgtgtgtgtgtatatatatatttttggataatgctaaagtcaccaa gtttttaaaccaaattatgtgtcacagtataaaataaacacgttaatcaa cacttaaataataattcaatcatcaacatctacatcatttgattacaaaa aagtttgtcttcctagcattactctatattttttttatatatacatatac tcaacacaggttttcatgcaggcgtgtagaaatattacaattaatttaaa atttaatcataaattatttctattatatattattatattgtcagataaaa atgctcgaaccccagttggtaatgatttggccgaacgta
back to top